ID: 987923631

View in Genome Browser
Species Human (GRCh38)
Location 5:24314121-24314143
Sequence TGTCTAATACTGACAGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987923630_987923631 4 Left 987923630 5:24314094-24314116 CCTTGTTAATTTTCTGTCTCATC 0: 18
1: 735
2: 1857
3: 3830
4: 4328
Right 987923631 5:24314121-24314143 TGTCTAATACTGACAGTGACAGG No data
987923629_987923631 13 Left 987923629 5:24314085-24314107 CCTGAATATCCTTGTTAATTTTC 0: 1178
1: 1730
2: 3445
3: 3619
4: 4353
Right 987923631 5:24314121-24314143 TGTCTAATACTGACAGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987923631 Original CRISPR TGTCTAATACTGACAGTGAC AGG Intergenic
No off target data available for this crispr