ID: 987926005

View in Genome Browser
Species Human (GRCh38)
Location 5:24342732-24342754
Sequence CTTATTACACAGATCATACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987926004_987926005 -2 Left 987926004 5:24342711-24342733 CCACAACGGCAGAGTGAAGTACT No data
Right 987926005 5:24342732-24342754 CTTATTACACAGATCATACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987926005 Original CRISPR CTTATTACACAGATCATACA CGG Intergenic
No off target data available for this crispr