ID: 987928807

View in Genome Browser
Species Human (GRCh38)
Location 5:24376329-24376351
Sequence CATAGTATGTAAAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987928804_987928807 5 Left 987928804 5:24376301-24376323 CCATTTGAAAAAATTTACTCCAT No data
Right 987928807 5:24376329-24376351 CATAGTATGTAAAAGAAGGAAGG No data
987928803_987928807 18 Left 987928803 5:24376288-24376310 CCTTATTGCTGTACCATTTGAAA No data
Right 987928807 5:24376329-24376351 CATAGTATGTAAAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987928807 Original CRISPR CATAGTATGTAAAAGAAGGA AGG Intergenic
No off target data available for this crispr