ID: 987930645

View in Genome Browser
Species Human (GRCh38)
Location 5:24396110-24396132
Sequence AGTTATGTGCAAGGTGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987930645_987930647 4 Left 987930645 5:24396110-24396132 CCTTATACACCTTGCACATAACT No data
Right 987930647 5:24396137-24396159 TTTCCAATAGTATTACATTCAGG No data
987930645_987930649 7 Left 987930645 5:24396110-24396132 CCTTATACACCTTGCACATAACT No data
Right 987930649 5:24396140-24396162 CCAATAGTATTACATTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987930645 Original CRISPR AGTTATGTGCAAGGTGTATA AGG (reversed) Intergenic
No off target data available for this crispr