ID: 987934919

View in Genome Browser
Species Human (GRCh38)
Location 5:24451359-24451381
Sequence CAGCATTCAGCAGTGATGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987934912_987934919 23 Left 987934912 5:24451313-24451335 CCTGCTGGATCCGGAGGGGTGGA 0: 17
1: 53
2: 127
3: 140
4: 211
Right 987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG No data
987934910_987934919 24 Left 987934910 5:24451312-24451334 CCCTGCTGGATCCGGAGGGGTGG 0: 17
1: 68
2: 120
3: 148
4: 241
Right 987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG No data
987934914_987934919 13 Left 987934914 5:24451323-24451345 CCGGAGGGGTGGAAGTCAGCGGA No data
Right 987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987934919 Original CRISPR CAGCATTCAGCAGTGATGGA CGG Intergenic
No off target data available for this crispr