ID: 987940433

View in Genome Browser
Species Human (GRCh38)
Location 5:24528666-24528688
Sequence ATGCATGTTGATACAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987940433 Original CRISPR ATGCATGTTGATACAGAGAC AGG (reversed) Intronic
902977170 1:20097387-20097409 TGGCATGTTGATACAGGCACTGG - Intergenic
903654246 1:24939399-24939421 ATGCATGATGATGCAGACAGAGG - Intronic
904789600 1:33009148-33009170 AGGCATCTTGTTACAGAGAGAGG - Intronic
904866229 1:33581026-33581048 ATGCCTGTGGATGCAGAGAGAGG - Intronic
910601649 1:89039142-89039164 ATGACTGTTGAAACAGAGATGGG + Intergenic
910665452 1:89721608-89721630 ATGCATTTAGAAACAAAGACAGG + Intronic
910710711 1:90177011-90177033 ATGCTTGTTGATACAGATCCTGG - Intergenic
910893883 1:92046879-92046901 ATGCATGATGATACAAAACCAGG - Intronic
915786050 1:158613190-158613212 ACCCATGTTGAAACAGAGTCTGG - Intronic
920406171 1:205713482-205713504 ATGCAGATACATACAGAGACTGG + Exonic
922918647 1:229280704-229280726 ATTGATGTTGACACAGATACAGG + Intronic
923214510 1:231835940-231835962 ATGCATATTAATACACAGAGTGG - Intronic
1063535639 10:6880048-6880070 ATGCATATTGATACTGAAGCTGG + Intergenic
1067367595 10:45648581-45648603 ATGCATCTTGGTACAGTGACAGG + Intronic
1072270835 10:93774634-93774656 ATGCTGGTTGATTTAGAGACTGG + Intronic
1072545488 10:96433605-96433627 ATGCATGCGGATTCAGTGACTGG - Intronic
1073623896 10:105076454-105076476 ATGCAAGTTGAGAGAGAAACAGG - Intronic
1076105062 10:127815238-127815260 ATGGATGTTGCTATAGAAACTGG - Intergenic
1078082546 11:8214766-8214788 CTGCATGGAGATACAGAGAAAGG - Intergenic
1078328298 11:10398157-10398179 CTGCCTGTTGCTACAGAGAGAGG + Intronic
1079744934 11:24113938-24113960 ATGAATGTTGGAAAAGAGACAGG + Intergenic
1079827978 11:25222561-25222583 ATCTATGTTGATACACTGACAGG - Intergenic
1081068017 11:38571830-38571852 ATGCAATTTGATACAGAAAAAGG + Intergenic
1081301880 11:41462667-41462689 ATGGATTTTGATACACAGAGGGG + Intergenic
1086780009 11:90892312-90892334 ACACATGTAGACACAGAGACTGG - Intergenic
1087650726 11:100864127-100864149 ATGCCTGTTGCTACATAGACCGG + Intronic
1088554141 11:111044475-111044497 ATCCATGTTGCTACAAAGACAGG + Intergenic
1089122761 11:116149635-116149657 ATACATGTAGATATAGATACAGG + Intergenic
1089617353 11:119702373-119702395 AAGCCTTTTGATACAGAGCCTGG + Intronic
1090502322 11:127273435-127273457 ATGAATGTTGATTCTGAGTCAGG - Intergenic
1090555886 11:127875172-127875194 TTGCAGATGGATACAGAGACTGG - Intergenic
1092867909 12:12780598-12780620 ATTTATTTTGATACAGAGTCTGG + Intronic
1097767899 12:63546727-63546749 ATAGATGTAGATACAGAGACAGG + Intergenic
1097784260 12:63741789-63741811 ATAGATGTAGATACAGAGACAGG + Intergenic
1100514690 12:95315830-95315852 ATACATGTTAATACAGATAAAGG + Intergenic
1101065910 12:101020508-101020530 CTGGATGATGATACAGAGATAGG + Intronic
1101277795 12:103221641-103221663 AAGCATCATGATACAGAGAAAGG + Intergenic
1103467068 12:121150264-121150286 GTTCATGATGACACAGAGACAGG + Intronic
1104681938 12:130758096-130758118 ATGGATATTGATATAGAGAGAGG + Intergenic
1106777640 13:33024427-33024449 ATGGATGATGAGACAGAGGCAGG - Intronic
1110302813 13:73949210-73949232 GTGCATATTGATATAGAGAAAGG - Intronic
1110563884 13:76938440-76938462 AGGCACCTTGATACAGAGAACGG - Intergenic
1112164159 13:96899663-96899685 ATGCAAAATGATTCAGAGACTGG + Intergenic
1113638914 13:111943474-111943496 ATGCAAGTGGAGACAGAGGCTGG - Intergenic
1117678125 14:58175707-58175729 ATTAATGTTGATACAGGGCCAGG - Intronic
1117848469 14:59939565-59939587 ATGCATGTTCATAGAGAAAGTGG + Intronic
1120072164 14:80115933-80115955 ATTCATTTTGATACAGAAATAGG - Intergenic
1121844006 14:97157482-97157504 ATGCAGGGTGATACCAAGACAGG - Intergenic
1123131795 14:105993211-105993233 ATGCATGCTGTCACAGAGGCAGG + Intergenic
1125968388 15:43892499-43892521 ATGCATGTCCACACAGAAACTGG + Intronic
1129921451 15:79322558-79322580 ATGCATCATGAAACAGAGGCAGG - Exonic
1130375547 15:83325841-83325863 ATGCATATGCATACAGAGAGGGG - Intergenic
1131842837 15:96455886-96455908 AGGCATTTTAATACACAGACAGG + Intergenic
1133384284 16:5356145-5356167 GTGCAGGTGGATGCAGAGACTGG + Intergenic
1133664863 16:7956715-7956737 TTGCATGTGGATACAAAGAGAGG + Intergenic
1137502313 16:49020812-49020834 ATGAATGCAGATACAGAGTCGGG + Intergenic
1137761331 16:50942772-50942794 ATGCACGTAGAAAAAGAGACAGG - Intergenic
1140176923 16:72670780-72670802 ATGCATGTTGAGAAAGAGAACGG - Intergenic
1140567502 16:76061230-76061252 AAGCATGAAGATACAGATACTGG - Intergenic
1142161529 16:88560204-88560226 GTGCATGTTGAGGGAGAGACGGG - Intergenic
1148747455 17:49926680-49926702 ATGCATGATGAGAGAGAGAGGGG + Intergenic
1150063873 17:62092312-62092334 ATGCTTATTTTTACAGAGACAGG - Intergenic
1150459692 17:65338851-65338873 TTGCATGTTGAGCCAGAGTCGGG + Intergenic
1152768942 17:82155888-82155910 ATGCATGTAGACACAGAGCCTGG + Intronic
1155395058 18:25378199-25378221 ATGGATGTTGAACCAGAGAACGG - Intergenic
1155867677 18:30986189-30986211 ATGCATGTTGATGTATAGATTGG + Intergenic
1159407647 18:68025917-68025939 ACGCATGTCCATACAAAGACAGG - Intergenic
1164606372 19:29601345-29601367 ATGCATGTTTAAACAGGGCCTGG - Intergenic
1167680039 19:50913442-50913464 AGGCAAGGTGAGACAGAGACAGG - Intergenic
1168276864 19:55283781-55283803 ATGCTGGCTGACACAGAGACGGG - Intronic
926760885 2:16278090-16278112 ATGCCTGTTGACACATAGATGGG - Intergenic
927509193 2:23633964-23633986 ATCCCTGTTAATAGAGAGACTGG - Intronic
929343987 2:40858537-40858559 ATACATGTGGATATAGACACAGG + Intergenic
929411716 2:41704026-41704048 ATGCATGCTTACACACAGACAGG - Intergenic
931331722 2:61293605-61293627 ATGCTTGTTGATTCAGTAACTGG + Intronic
931337850 2:61366529-61366551 TTGCATGTAAATACAGATACTGG + Intronic
932958078 2:76379382-76379404 ATGCATTTTGATACAGATTAAGG + Intergenic
935143037 2:100371472-100371494 ATGCATTTTTTTATAGAGACGGG - Intergenic
936924002 2:117718394-117718416 CAGCTTGTTGAAACAGAGACTGG - Intergenic
939340365 2:140887586-140887608 ATGCATGTTCACACAAAAACTGG + Intronic
939892502 2:147754200-147754222 ATGCATGTTCATTCTGAGACGGG + Intergenic
943353313 2:186821132-186821154 ATGCAAGTTGATAATGAGAAAGG + Intergenic
944581050 2:201133189-201133211 ACTCTTGTTGATACAGAGAGAGG + Intronic
946002375 2:216493334-216493356 ATCCATGTTGATACAAACAAAGG - Intergenic
946055266 2:216895632-216895654 ATGGATGTGGAGACAGAGAGGGG + Intergenic
1169597487 20:7217178-7217200 ATGCATGTTGATGCACATAATGG + Intergenic
1170360812 20:15544067-15544089 AAGGATGTGGATACAGAGTCGGG + Intronic
1170406920 20:16047782-16047804 TAGATTGTTGATACAGAGACAGG + Intronic
1170586958 20:17741952-17741974 ATCCATGTTGCTGCAGTGACAGG - Intergenic
1170765288 20:19284742-19284764 AAGCCTGTAGATTCAGAGACTGG + Intronic
1171233030 20:23502415-23502437 CTGCATGTTGTTGCAGAGTCAGG - Intergenic
1171565576 20:26182455-26182477 ATGGATCTTGGTACAGAGAAGGG - Intergenic
1173488999 20:43464066-43464088 ATACATGGTAATACAGAGATCGG + Exonic
1174726321 20:52866108-52866130 CTACATGTTGATACGGAGAGGGG + Intergenic
1177736384 21:25095768-25095790 AAGCATATTGAGACAGAGCCAGG + Intergenic
1178186095 21:30222628-30222650 ATGCATGTTGCTGCAGAAAATGG - Intergenic
1178285555 21:31322639-31322661 ATGCATCGTGACACAGAGACAGG - Intronic
1182958205 22:34447113-34447135 ATATTTGTTGATACAGACACTGG - Intergenic
1183004280 22:34888076-34888098 ATCTATGATGATACAGAGAAAGG - Intergenic
951284894 3:20798359-20798381 GTACATGTTGATACAAAGAGGGG - Intergenic
952461871 3:33536014-33536036 ATGAATATTGATACAAATACTGG + Intronic
955201797 3:56858303-56858325 ATGCATGTGGATACAGTGAATGG - Intronic
955677569 3:61464672-61464694 ATCCGTGTGGATTCAGAGACAGG - Intergenic
955991959 3:64637480-64637502 ATGCCTGTTAATACATAGAAAGG + Intronic
956837991 3:73111361-73111383 CTGCATGCAGATACAGAAACGGG - Intergenic
957159148 3:76585827-76585849 ACGCATGTACATACAGACACAGG - Intronic
959680106 3:109085928-109085950 ATCCATGTTGCTACAGTGACAGG - Intronic
960330635 3:116356262-116356284 ATCCATGTTGTTACAGAGACAGG - Intronic
961597310 3:128028644-128028666 ATAAATGTTAATGCAGAGACTGG - Intergenic
962039331 3:131688458-131688480 ATGCATGTAGAAACAGAAACTGG - Intronic
962852407 3:139317970-139317992 CTGCAGGATGATACAGAGCCAGG + Intronic
963862514 3:150325481-150325503 AGGCATGTTGTTAGAGGGACAGG - Intergenic
963997963 3:151733019-151733041 ATCTATGTTGAAACAGAAACTGG + Intergenic
967128893 3:186452410-186452432 GTGGATGTTGGTACAGAGGCAGG + Intergenic
970124235 4:12791504-12791526 AGGCATGTTGAAAGAGACACAGG + Intergenic
971568951 4:28185165-28185187 ATGAATGTTGATACATATAAAGG - Intergenic
971779783 4:31018450-31018472 AAAGATGTTGATATAGAGACAGG - Intronic
972029084 4:34429626-34429648 ATGGATCTTGGTACAGAGAAGGG - Intergenic
973074962 4:45912632-45912654 CTGCATTTTTATAAAGAGACTGG - Intergenic
973988753 4:56381973-56381995 TTGCATTTTGAAAAAGAGACTGG - Intronic
974676712 4:65100391-65100413 ATGAATGTTGAAATAGTGACAGG - Intergenic
976138555 4:81965204-81965226 ATCCATGTTGCTGCAAAGACAGG + Intronic
976666710 4:87602378-87602400 ATGCATGTATATACATAGAGAGG + Intergenic
976961040 4:90973886-90973908 ATTCATGTTGTTACAATGACAGG - Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
981622682 4:146721478-146721500 ATGCAAGGTGCTACAGATACAGG - Intronic
982890421 4:160842262-160842284 ATCCATGTTTGTACAGACACTGG + Intergenic
984235370 4:177151064-177151086 ATCCATGTTGTTACATAGGCAGG - Intergenic
985324074 4:188747795-188747817 ATGCACATGGATATAGAGACTGG - Intergenic
985776299 5:1844728-1844750 ATACATGTAGGTACAGATACAGG - Intergenic
987940433 5:24528666-24528688 ATGCATGTTGATACAGAGACAGG - Intronic
989290871 5:39763689-39763711 ATCCATGTTGTTGCAAAGACAGG + Intergenic
992379519 5:76223420-76223442 ATGTATGTATATAAAGAGACAGG - Intronic
999232716 5:150070986-150071008 AGCCATGTTGCTGCAGAGACTGG + Intronic
1000072005 5:157749288-157749310 ATGTATGTTTATACAAAGAGTGG - Intronic
1000518079 5:162264884-162264906 ATCCATGTTGTTGCAAAGACAGG - Intergenic
1001621925 5:173094076-173094098 ATCCATGTTATTACAAAGACAGG + Intronic
1002910008 6:1482889-1482911 ATGTATGTGCATTCAGAGACAGG - Intergenic
1003096106 6:3144798-3144820 GTGCATGTTGAAAGAGAGAGAGG + Intronic
1003548624 6:7082658-7082680 ATCCATTTTGAGACAGGGACTGG + Intergenic
1004564439 6:16782139-16782161 ATGGATGTTAATAGAGAGAAGGG - Intergenic
1004669935 6:17786278-17786300 ATACATGATGTTACAAAGACAGG + Intronic
1008133281 6:47742387-47742409 ATGCATGTTTATATATATACAGG - Intergenic
1015401509 6:132793516-132793538 TTGCATGTTGTCACAGAGTCAGG - Intronic
1018134137 6:160762816-160762838 ATCCATGTTGATGCAAAGGCAGG - Intergenic
1024758329 7:52563240-52563262 TTGCATGTTGATAAAGTGAAAGG + Intergenic
1027839699 7:83293250-83293272 GTGCATGTGGATACAGAGGATGG + Intergenic
1028234236 7:88341300-88341322 ATGCATTTTGATATAGAATCTGG - Intergenic
1028293664 7:89099884-89099906 CTTCATGTTGATACCCAGACTGG + Intronic
1028427009 7:90700646-90700668 ATGCATGTATATCCACAGACTGG - Intronic
1028759388 7:94478509-94478531 AATTATGTTGAAACAGAGACAGG + Intergenic
1030078758 7:105759223-105759245 ATGAATGTTGATACAGTCATGGG + Intronic
1031003069 7:116439784-116439806 ATGCATTTTGATCCTGAAACAGG + Intronic
1036134057 8:6142658-6142680 ATGGATGTTGATACTGAATCTGG + Intergenic
1038312231 8:26453501-26453523 TTGTATTTTGTTACAGAGACGGG + Intronic
1039535103 8:38303087-38303109 ATGCATGCTTATACACTGACAGG + Intronic
1042224435 8:66504437-66504459 CTGCATGTTTATACATAGGCAGG - Intronic
1045240717 8:100398714-100398736 ATGCCTGTTAATACATAGCCTGG - Intronic
1047711912 8:127561051-127561073 ATCCATGTGGATAAAGTGACTGG - Intergenic
1047921134 8:129635759-129635781 ATGCATGGTGCTCAAGAGACAGG + Intergenic
1048560911 8:135536566-135536588 ATGGAAGTGGATACAGAGAAAGG + Intronic
1052262690 9:26536187-26536209 ATGCATGATGAGCCAGAGAAGGG + Intergenic
1052517892 9:29507247-29507269 ATCCATGTTGAAACAAAGAAAGG + Intergenic
1053832226 9:42095666-42095688 ATTCTGGCTGATACAGAGACTGG + Intronic
1054598318 9:67091754-67091776 ATTCTGGCTGATACAGAGACTGG - Intergenic
1056860008 9:90172450-90172472 AATCATGTTGATTCAAAGACAGG + Intergenic
1203441577 Un_GL000219v1:14533-14555 ATACACTTGGATACAGAGACTGG + Intergenic
1203512386 Un_KI270741v1:133441-133463 ATACACTTGGATACAGAGACTGG + Intergenic
1186386004 X:9110744-9110766 ATCCAGGTTGATGCAGGGACTGG - Intronic
1187481932 X:19664694-19664716 CTGCATGTTGATATTGTGACAGG + Intronic
1194312493 X:92329662-92329684 ATCCATGTTGATGCAAAGACTGG - Intronic
1194864154 X:99045067-99045089 ATCCATGTTTATACAGACAATGG + Intergenic
1195421916 X:104685020-104685042 AGGCAAATTGAGACAGAGACAGG + Intronic
1196066559 X:111470927-111470949 ATACATGTTGATACAGGTATTGG + Intergenic
1199195918 X:145030623-145030645 ATGAATATGGATACAGATACAGG - Intergenic
1199240291 X:145540454-145540476 ATACATGTTGGTACTGAGAATGG + Intergenic
1200620758 Y:5443795-5443817 ATCCATGTTGATGCAAAAACTGG - Intronic