ID: 987947897

View in Genome Browser
Species Human (GRCh38)
Location 5:24637188-24637210
Sequence ACTTGGGAAGACAGGGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 734
Summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 677}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987947897_987947903 8 Left 987947897 5:24637188-24637210 CCTCTTTCCCTGTCTTCCCAAGT 0: 1
1: 0
2: 2
3: 54
4: 677
Right 987947903 5:24637219-24637241 CTGGATGCTTGCACAGTGTCTGG No data
987947897_987947904 15 Left 987947897 5:24637188-24637210 CCTCTTTCCCTGTCTTCCCAAGT 0: 1
1: 0
2: 2
3: 54
4: 677
Right 987947904 5:24637226-24637248 CTTGCACAGTGTCTGGCTTATGG 0: 1
1: 0
2: 7
3: 66
4: 474
987947897_987947905 19 Left 987947897 5:24637188-24637210 CCTCTTTCCCTGTCTTCCCAAGT 0: 1
1: 0
2: 2
3: 54
4: 677
Right 987947905 5:24637230-24637252 CACAGTGTCTGGCTTATGGTAGG 0: 1
1: 3
2: 29
3: 239
4: 1178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987947897 Original CRISPR ACTTGGGAAGACAGGGAAAG AGG (reversed) Intronic
900181977 1:1315193-1315215 ACTTGGGAAGAGAGAGAAGGAGG + Intronic
900250788 1:1668094-1668116 ACTTGAGAGGACAAGGCAAGTGG - Intronic
900261758 1:1734457-1734479 ACTTGAGAGGACAAGGCAAGTGG - Intronic
901503162 1:9666474-9666496 ACTTGGGAGGCCAGGGCAGGTGG - Intronic
901558167 1:10048090-10048112 CCTTGGGAAGCCAAGGAAGGAGG - Intronic
902107725 1:14051729-14051751 ACTTGGGAAGCCAAGGTGAGAGG + Intergenic
902176255 1:14653210-14653232 AATTGGAAAGTGAGGGAAAGAGG + Intronic
902243857 1:15106367-15106389 AGAAGGGAAGTCAGGGAAAGGGG - Intronic
902842439 1:19083761-19083783 ACTTGGGAGGCCAAGGTAAGAGG - Intronic
903865070 1:26392016-26392038 ATTTGGGAGGAGGGGGAAAGAGG - Intergenic
904057817 1:27683869-27683891 ATTTGGGAGGACAAGGCAAGAGG - Intergenic
904483666 1:30809956-30809978 ACTTGGGGATGCAGGAAAAGAGG - Intergenic
904846376 1:33421256-33421278 CCTTGGGGAAACAGGAAAAGAGG + Intronic
904866961 1:33587027-33587049 ACTGGGGAAGGAAGGGAAGGTGG - Intronic
904878100 1:33671978-33672000 AATTGGAAAGACATGCAAAGGGG + Intronic
905380320 1:37557195-37557217 AATTGGGAAGTCAGAGAAGGAGG + Intronic
905440929 1:37996328-37996350 CCTTGGGAAGAGGGGGAAGGGGG + Intergenic
905618238 1:39416399-39416421 ATTTGGGAAGCCAAGGGAAGAGG + Exonic
905671399 1:39792684-39792706 ACCTGACCAGACAGGGAAAGGGG - Intergenic
905713001 1:40123288-40123310 ACTAGGGATGACAGCAAAAGAGG + Intergenic
905927361 1:41760932-41760954 ATTTGAGAGGACAGGTAAAGTGG - Intronic
906215466 1:44035757-44035779 GATTGGGAAGACAGGAAGAGGGG + Intergenic
906339876 1:44970013-44970035 TCTTGATAAGTCAGGGAAAGAGG + Intronic
906627853 1:47340060-47340082 AATAGGAAAGAAAGGGAAAGGGG - Intronic
906746924 1:48228577-48228599 AAGTGGGAAAAAAGGGAAAGTGG - Intronic
907191772 1:52655371-52655393 ACTTGGGAAGCCAAGGCAGGAGG + Intronic
907604550 1:55803741-55803763 AATTGGAAACACAGGGAAAAGGG - Intergenic
907751624 1:57268883-57268905 AGTTGAAAAGTCAGGGAAAGAGG + Intronic
907923131 1:58931557-58931579 ACTTGGGGACACAGGGGATGTGG - Intergenic
908498151 1:64716003-64716025 ACTTGGGAGGCTAGGGGAAGAGG - Intergenic
908730065 1:67216940-67216962 ACTTGGGCAGAAAGGGGAGGAGG + Intronic
909342166 1:74544555-74544577 ACTTGGCATGACATGGAAAGGGG - Intergenic
909616968 1:77621706-77621728 ACTTGGGAAGCCAAGGCAGGAGG + Intronic
910042215 1:82866548-82866570 ACTTGAGGAGACAGTGAAGGGGG + Intergenic
910200290 1:84691274-84691296 ACTGGGGAAGAAAAGAAAAGAGG + Intergenic
911001755 1:93173055-93173077 ACTTGGGGAGAGAGGGAATAGGG + Intronic
911460945 1:98189856-98189878 ACTTAGGAAGATCAGGAAAGAGG - Intergenic
912681243 1:111730294-111730316 AGTTGGGAAGACAAGGAAAGTGG - Intronic
913075896 1:115339848-115339870 ACTTTGGAAGTGAGGGCAAGAGG + Intergenic
913578318 1:120199630-120199652 ACTTGGGAGGCCAAGGCAAGAGG - Intergenic
913584015 1:120255326-120255348 AGTGGGGAAAACAGGTAAAGAGG - Intergenic
913624166 1:120643015-120643037 AGTGGGGAAAACAGGTAAAGAGG + Intergenic
913629854 1:120698721-120698743 ACTTGGGAGGCCAAGGCAAGAGG + Intergenic
914320139 1:146551289-146551311 ACTTGGGAGGCCAAGGTAAGAGG + Intergenic
914560241 1:148811070-148811092 ACTTGGGAGGCCAAGGCAAGAGG - Intronic
914566002 1:148867194-148867216 AGTGGGGAAAACAGGTAAAGAGG - Intronic
914606820 1:149263046-149263068 AGTGGGGAAAACAGGTAAAGAGG + Intergenic
914612592 1:149319145-149319167 ACTTGGGAGGCCAAGGCAAGAGG + Intergenic
914677955 1:149918098-149918120 AAGTGGGAAGACAGGGAGATGGG + Intergenic
914771735 1:150692634-150692656 ACTTGGGAGGCCAAGGTAAGAGG - Intronic
915058204 1:153156784-153156806 ATTTGGGGAGAGAGGTAAAGAGG + Intergenic
916699607 1:167277828-167277850 ATTTGGGAAGTGAGGGAGAGGGG - Intronic
916799323 1:168200937-168200959 ATTTGGGAAGATAGGTAAGGAGG + Exonic
917144229 1:171870900-171870922 ATTTGAGAAGACAGAGAAAAAGG + Intronic
917979241 1:180259198-180259220 GCTTGGGAGGCCAGGGAGAGGGG + Intronic
918078096 1:181185644-181185666 ACCTGGGAAGATGGGGAAGGTGG - Intergenic
918560983 1:185867330-185867352 ACCTGGGAAGAAAGGGATTGGGG + Intronic
919382229 1:196873558-196873580 ACTTGAAAACACAGTGAAAGAGG + Intronic
919766463 1:201130388-201130410 AATGGGGAAGACTGGGACAGTGG + Intergenic
920032863 1:203048045-203048067 ACCTGGGAAGAAAGGCAATGGGG + Intronic
920389906 1:205593055-205593077 ACTCGGGAGGCTAGGGAAAGGGG - Intronic
920401552 1:205679786-205679808 AGTTATTAAGACAGGGAAAGGGG - Intronic
920518420 1:206603758-206603780 CCTTAGGAAGACAGGAAAACAGG + Intronic
920522381 1:206637198-206637220 ACTGGGGAAGACAGGCTCAGAGG + Intronic
920680685 1:208070171-208070193 AGATGGGAAGAAAGGGAAAGGGG - Intronic
921016447 1:211196417-211196439 ATTTGAGATGACAGTGAAAGGGG + Intergenic
921764234 1:218951930-218951952 ACTTGGGAAGACATTGGAATTGG - Intergenic
922794079 1:228330562-228330584 ACTTGGGAAGCTAAGGCAAGAGG + Intronic
923720795 1:236465054-236465076 ACTGGGGAAAACAGGAAAGGAGG - Intronic
923722753 1:236481398-236481420 TCTTGGAAAGAAAGGGAAACTGG + Intronic
1063147014 10:3304777-3304799 ACTGGGGAAGAGAGAGAAAAGGG + Intergenic
1063709907 10:8467517-8467539 TCTGAGGAAGTCAGGGAAAGTGG + Intergenic
1064175496 10:13071653-13071675 ACTTGGGGATACAAGGACAGAGG + Intronic
1064538603 10:16383648-16383670 AACTGGGAAGAAAGGGAATGTGG + Intergenic
1065106939 10:22398480-22398502 ACTTTGGAGGACAAGGCAAGAGG + Intronic
1065238360 10:23678833-23678855 ATTTGGGAAGCCAAGGCAAGAGG + Intergenic
1065613911 10:27500763-27500785 ACTTGGGAGGCTAAGGAAAGAGG + Intergenic
1065675062 10:28165279-28165301 GCTTGGGAAGTCAAGGCAAGAGG + Intronic
1066001015 10:31104004-31104026 ACTTGGGAGGCCAAGGAAGGAGG + Intergenic
1066694474 10:38065684-38065706 CCATGGGAAGACATGGAAATTGG - Intergenic
1067390801 10:45861696-45861718 ACTTGGAAAAACATGGATAGTGG + Intergenic
1067840816 10:49677732-49677754 ACTTGGGAAGAAACTGAAAGTGG + Intergenic
1067872478 10:49974408-49974430 ACTTGGAAAAACATGGATAGTGG - Intronic
1067925141 10:50501089-50501111 ACATGGGATGAGAGGGAAGGAGG - Intronic
1067981847 10:51096167-51096189 AATTGGAAGGAAAGGGAAAGAGG + Intronic
1068072805 10:52217120-52217142 ATTTTGGAAGAAAGGGAAACAGG - Intronic
1068145877 10:53069968-53069990 ACTTGGGAAGAAAAAGAAAAAGG - Intergenic
1068630155 10:59289862-59289884 GCTTGGGGAGGCAGGGAGAGTGG - Intronic
1068731774 10:60366222-60366244 ACTTGGGAGGCCAAGGCAAGAGG + Intronic
1068840842 10:61612165-61612187 AGTTGAGAAGACAGAGAAATTGG + Intergenic
1069068108 10:63966495-63966517 ACTTGGGAAGATAGAGAGGGAGG + Intergenic
1069413430 10:68175861-68175883 ACTTGGGAAGCTAAGGCAAGAGG - Intronic
1069783613 10:70974048-70974070 ACTTGGGGAGAAAGGGTAGGGGG + Intergenic
1070037683 10:72742921-72742943 AGGTAGGAAGTCAGGGAAAGGGG + Intronic
1071097318 10:81992692-81992714 AAATGGGAAGACAGAAAAAGAGG - Intronic
1071116010 10:82221247-82221269 AATTGGCAAGACAGAGAAAGAGG + Intronic
1071222967 10:83491485-83491507 ACTTGGGAAGCTGGGGTAAGAGG - Intergenic
1072342884 10:94472158-94472180 ACTTTGGGAGACAGGGCGAGAGG + Intronic
1072497184 10:95973334-95973356 ACTTGGGAATGTAAGGAAAGAGG + Intronic
1072665720 10:97390914-97390936 ACTAAGGAGGACAGGGCAAGGGG + Intronic
1072707994 10:97695992-97696014 ACTTGGGAGGCGAGAGAAAGGGG - Intergenic
1072739863 10:97902823-97902845 TCTGGGGAGGCCAGGGAAAGAGG + Intronic
1072762557 10:98068927-98068949 ACTTTGGAAGACAGGGTACCCGG - Intergenic
1073201384 10:101738577-101738599 ACTTGGGAAGCCAAGGTAGGAGG + Intergenic
1073370413 10:102983682-102983704 CTTTGGGAAGACAAGGAAGGAGG - Intronic
1073556126 10:104453510-104453532 AGTAGGGTAGACAGGGGAAGTGG - Intronic
1074214892 10:111374618-111374640 AGTGGAGAAGAGAGGGAAAGGGG + Intergenic
1074369328 10:112886895-112886917 CTTTGGGAAGACAGAGAAAGGGG - Intergenic
1074914180 10:117939729-117939751 TGTTGGGAAGCCAAGGAAAGAGG + Intergenic
1075548017 10:123370161-123370183 ACTTGTGAAGACAGGCAGAGTGG + Intergenic
1075764381 10:124880809-124880831 CTTTGGGAAGCCAAGGAAAGAGG + Intergenic
1076605393 10:131685996-131686018 ACTTGGAAAGAAAGAGAGAGAGG + Intergenic
1077361337 11:2141442-2141464 AATTGGGAACATAGAGAAAGAGG + Intronic
1077521145 11:3035727-3035749 CTTTGGGAAGCCAGGGCAAGAGG - Intronic
1077756115 11:5029376-5029398 ATTTGGGAAGCCAAGGCAAGGGG + Intergenic
1078436279 11:11328367-11328389 TCCAGGGAAGACAAGGAAAGAGG + Intronic
1078474392 11:11619146-11619168 ACTTGGAAAGACTGGAAATGAGG - Intronic
1078683235 11:13500508-13500530 ACTTAGGAGGACAGGGTTAGGGG + Intergenic
1079003269 11:16775157-16775179 ACTGGGGAAGACATGAAAAATGG - Intergenic
1079899858 11:26168826-26168848 ACTGAGGAAGACAGAGAAAGTGG - Intergenic
1079966904 11:26991122-26991144 AGTTGGGAAGACATGCACAGTGG - Intergenic
1080331465 11:31144533-31144555 ACTAGTGAATACAGGGAAACTGG - Intronic
1080594524 11:33758812-33758834 ACTTAGTAAAACATGGAAAGTGG + Intronic
1081024503 11:37993507-37993529 ACTAGTGAAGTTAGGGAAAGAGG + Intergenic
1081103592 11:39035734-39035756 ACTTGAGAGATCAGGGAAAGAGG + Intergenic
1081611806 11:44567427-44567449 ACTTGAGAAGCCAGGGCAGGGGG + Intronic
1081652013 11:44830479-44830501 AGTTGGGCAGACAAGGGAAGGGG + Intronic
1081779101 11:45697539-45697561 TCTTGGGAGAACTGGGAAAGAGG + Intergenic
1081858285 11:46317396-46317418 ACTCGGGAAGGCAGGGCACGAGG - Exonic
1081999179 11:47383619-47383641 TTTTGGGGAGACAGGGACAGTGG + Intergenic
1082205587 11:49430146-49430168 CCTTGGGAAAAAAGAGAAAGAGG + Intergenic
1082783492 11:57303804-57303826 ACTTGGGAGGCCAGGGCAGGGGG + Intronic
1082807798 11:57461278-57461300 ACCTGGGAAGACAGGAGATGTGG + Intronic
1083125902 11:60565394-60565416 ACTTGGGGATACAAGGACAGAGG - Intergenic
1083683859 11:64364451-64364473 ACTAAGGAAGACAGGGAGAATGG + Intronic
1084771013 11:71343051-71343073 ACAGGGGAACACAGGGAAGGTGG + Intergenic
1085174348 11:74473479-74473501 ACCTGGGCTGACAGGGCAAGGGG + Intergenic
1085534032 11:77207485-77207507 ACTGGGGGAGAGAGGGGAAGAGG + Intronic
1086649512 11:89270372-89270394 CCTTGGGAAAAAAGAGAAAGAGG - Intronic
1087863761 11:103197554-103197576 ACTTGGGAAGCTAAGGCAAGAGG - Intronic
1088747628 11:112817606-112817628 ACTTGGGATGACAGGGAGAGCGG + Intergenic
1088776322 11:113087285-113087307 AGATGGGAAGACAGGGAAATAGG - Intronic
1088937531 11:114418237-114418259 AGTGGGGTAGACAGGGAAAGGGG + Intronic
1089037269 11:115407759-115407781 ACTTGGGAAGCCAAGGAAGGAGG + Intronic
1089132971 11:116226580-116226602 ACTGGGGAAGAAAGGGGAACAGG + Intergenic
1090275236 11:125414157-125414179 ACTTGGGAAGGCAGAGGAAGGGG + Intronic
1090597478 11:128335155-128335177 ACTGAGAAACACAGGGAAAGAGG - Intergenic
1090748509 11:129726207-129726229 TCTGGGGAAGACAGGTATAGTGG + Intergenic
1090994987 11:131857967-131857989 ATTGGGGGAGACAGAGAAAGGGG - Intronic
1091541461 12:1466270-1466292 ACTGGGGAGCACAGGGAGAGAGG - Intronic
1091716562 12:2781487-2781509 ACTTGGGAGGCCAAGGAGAGCGG - Intergenic
1091730312 12:2876131-2876153 ACTTTGGAAGACAGAGGAATTGG + Intronic
1091818907 12:3459761-3459783 ACCTTGGAAGACAGGGGAGGAGG - Intronic
1092099846 12:5873984-5874006 ACTTGGGCAGACCAGGATAGAGG + Intronic
1092353659 12:7776889-7776911 GCTAAGGAAGACAGGGAGAGTGG + Intergenic
1092973724 12:13724017-13724039 ACTTAGGAAGACAGTAAGAGAGG + Intronic
1093401012 12:18746440-18746462 ACTTGGGAGGCCAGAGCAAGAGG - Intergenic
1093621864 12:21301473-21301495 AATTTGGAGGCCAGGGAAAGTGG - Intronic
1093755812 12:22850774-22850796 ACTTTGGAAGAGAGGGAGACAGG - Intergenic
1093825694 12:23685261-23685283 ACTTTAGAAGACAGAGAAAAGGG + Intronic
1094175338 12:27535640-27535662 TCTTGGGAAGCCAAGGCAAGAGG - Intronic
1094348441 12:29497486-29497508 ATTTGGGAAGAAAGGGTGAGGGG - Intronic
1095049984 12:37546524-37546546 ACCTGGGCAGACAGAGCAAGAGG - Intergenic
1095473294 12:42559705-42559727 CTTTGGGAAGACAAGGCAAGAGG - Intronic
1095907078 12:47389492-47389514 ACTTGGAAAGACAGCAGAAGGGG + Intergenic
1096290032 12:50334411-50334433 CTTTGGGAGGACAAGGAAAGTGG - Intronic
1096329448 12:50697772-50697794 ACTTGGGAGGACAAGGAAGGTGG - Intronic
1096994173 12:55828802-55828824 ACTTGGGAAAACAAGGGAGGTGG - Intronic
1097242369 12:57584196-57584218 ACTGGGAAAGAAAGAGAAAGAGG - Exonic
1098322919 12:69266227-69266249 ACATGGGAAAACAAGGAAACAGG - Intronic
1099158547 12:79210397-79210419 ACTTGGGAAAAGTGGGAGAGGGG - Intronic
1099176669 12:79430043-79430065 GCTTAGGTAGAGAGGGAAAGAGG - Intronic
1100164679 12:91902903-91902925 ACTAGAGCAGACAGGGATAGTGG - Intergenic
1101175729 12:102149682-102149704 ACTAGGGAAGAAAGGGAGAATGG + Intronic
1101597768 12:106182401-106182423 ACTGAGAAAGACAGGAAAAGAGG + Intergenic
1101733532 12:107445898-107445920 AGATGGGAAGACAGGGAGAGGGG - Intronic
1101879462 12:108616619-108616641 ACTTGGGAGGGAAGGGATAGAGG - Intergenic
1101977716 12:109375868-109375890 ACTTGGGAAGCTAAGGCAAGAGG + Intronic
1102190041 12:110980870-110980892 AGGTGGGAAGAGAGAGAAAGTGG + Intergenic
1102270874 12:111534154-111534176 ACTTGGGAAGCCAAGGCAGGTGG + Intronic
1102584073 12:113910960-113910982 CCTGGTGGAGACAGGGAAAGAGG + Intronic
1102771251 12:115478911-115478933 ACTTGGGAAGCCAGAGCAGGAGG + Intergenic
1103538642 12:121651202-121651224 ACTTGGGAGGCCAAGGTAAGAGG - Exonic
1104134690 12:125926052-125926074 ACTTGGGAAAACAGGAAACATGG + Intergenic
1104153946 12:126112139-126112161 GCTTGAGAAGAAAAGGAAAGAGG + Intergenic
1105348933 13:19599160-19599182 ACTTGGGAAGCCAAGGCAGGAGG - Intergenic
1106014837 13:25858873-25858895 ACTTGACAAGAGAGGGAGAGAGG + Intronic
1106255847 13:28021279-28021301 ACTTGGGAAGCCAAGGCAGGAGG + Intronic
1108037761 13:46309416-46309438 ACTTGGGGAGACAGGGCACATGG - Intergenic
1108197777 13:48011883-48011905 ACTTTGGAAGTCAGGGACAGAGG - Intergenic
1108510705 13:51153202-51153224 ACTTGGCAGGACAGGGGAGGGGG - Intergenic
1110052066 13:70915509-70915531 ACTTACGAAGACAGGGGAATAGG - Intergenic
1110449918 13:75629807-75629829 AATTGACAAGACAGGGAATGGGG + Intronic
1111151531 13:84260273-84260295 TATTGGGAATTCAGGGAAAGGGG - Intergenic
1111311678 13:86495787-86495809 ACTTGGGAGAACAGGGGAATTGG + Intergenic
1112139403 13:96621574-96621596 TCTTGGAGAGAAAGGGAAAGAGG - Intronic
1112346092 13:98591089-98591111 ACTTGGGAAGCCAAGGCAGGAGG + Intergenic
1112609604 13:100943512-100943534 ACTTGGGAGGCCAGGGCAGGTGG + Intergenic
1113791137 13:113029032-113029054 ACCTGGGAAGAAAGGAAACGTGG - Intronic
1113950859 13:114070085-114070107 ACTTGGGGGGACCGGGAAACTGG + Intronic
1114373138 14:22112293-22112315 TTTTGGAAAGAAAGGGAAAGAGG - Intergenic
1114528548 14:23381085-23381107 ACTTGGGGAGTCAGGGAGATGGG + Intergenic
1114733902 14:25023417-25023439 AATTGGGAAGAGATGGAAAATGG - Intronic
1116528681 14:45938719-45938741 ACTTGACAAGACAAGAAAAGTGG - Intergenic
1116947269 14:50847396-50847418 AGTAGGGAAGTGAGGGAAAGGGG + Intergenic
1117397954 14:55329964-55329986 ATTTGGGAAGACAGAAAAGGAGG - Intronic
1117456914 14:55907133-55907155 GCTTTGAAAGACAGGAAAAGTGG - Intergenic
1118137844 14:63047220-63047242 AGGTGGGAAGAGAGAGAAAGGGG - Intronic
1118625620 14:67656389-67656411 GTCTGGGCAGACAGGGAAAGGGG - Intronic
1119468884 14:74881552-74881574 CCTTGGGAAGAGAGCAAAAGAGG - Intergenic
1121722369 14:96118607-96118629 AGCTGGGAAGACAGGGAAGAAGG - Intergenic
1121838661 14:97114885-97114907 GGTGGGGAAGGCAGGGAAAGGGG + Intergenic
1122012144 14:98759121-98759143 AGTTAGGAAGCCAGGGAAGGTGG - Intergenic
1122088257 14:99321729-99321751 AGTGGGGAAGACAGAGAATGGGG - Intergenic
1122111552 14:99506826-99506848 ACTTAGGTAGACATGGAAAATGG + Exonic
1122642070 14:103165765-103165787 ACAGGGAAAGACAGGGAAATAGG - Intergenic
1123031304 14:105452867-105452889 AATAGGAGAGACAGGGAAAGCGG + Intronic
1123152406 14:106195840-106195862 ACCTGGGAGGAGAGGGAAATCGG + Intergenic
1123179594 14:106456798-106456820 ACCTGGGAGGAGAGGGAAATTGG + Intergenic
1123213855 14:106787942-106787964 ACCTGGGAGGAGAGGGAAATTGG + Intergenic
1123218355 14:106832936-106832958 GCTTGGGAAGAGAGAGAAACTGG + Intergenic
1123942197 15:25221987-25222009 CCCTGGAAAGACAGGGCAAGTGG - Intergenic
1123946064 15:25239478-25239500 CCCTGGAAAGACAGGGCAAGTGG - Intergenic
1123948158 15:25248839-25248861 CCTTGGAAAGACAGGGAAGGTGG - Intergenic
1123948532 15:25250508-25250530 CCTTAGAAAGACAGGGTAAGTGG - Intergenic
1124009969 15:25830310-25830332 CCTTGGGAAGTCACTGAAAGGGG + Intronic
1124650062 15:31467844-31467866 AAGTGGAAAGAAAGGGAAAGTGG + Intergenic
1124890296 15:33726229-33726251 ACTTGTGGCCACAGGGAAAGAGG - Intronic
1125141336 15:36411247-36411269 ACCTGGGGAGGGAGGGAAAGGGG - Intergenic
1125163917 15:36680165-36680187 ATCTGGGAAGCCAGGGAAAAGGG - Intronic
1126838661 15:52694407-52694429 ACTTTGGAGGCCAAGGAAAGCGG - Intronic
1127361890 15:58251617-58251639 ACTGGGGAAGAGAGGGGAAGGGG + Intronic
1127743346 15:61937036-61937058 AGATGGGAAGATAGGGAAATGGG - Intronic
1128056847 15:64706094-64706116 ACTGGGGTAGACAGGGATAGAGG - Intergenic
1128273820 15:66335550-66335572 ACTTGGGAAGCTAAGGCAAGAGG + Intergenic
1129003574 15:72353829-72353851 ATTTGGGTACACAGGGAAAATGG + Intronic
1129198819 15:73986590-73986612 ACCAGGGATGACAGGGAAGGAGG + Intronic
1129209873 15:74062319-74062341 ACCTGGGATCACAGGAAAAGGGG - Intergenic
1131058752 15:89391634-89391656 GCTCAGGGAGACAGGGAAAGGGG - Intergenic
1131617205 15:94029018-94029040 ACAGGGGAAGAGAGGGAGAGAGG + Intergenic
1132105245 15:99058648-99058670 AGTGGGGAAGAGAGGGAAGGGGG + Intergenic
1132357790 15:101185555-101185577 ACCTGGGAAGGCGGGGAAGGGGG - Intronic
1132630406 16:914568-914590 TCATGGGAAGGGAGGGAAAGAGG - Intronic
1133412037 16:5577043-5577065 AATCTGGAAGACAGGGGAAGAGG - Intergenic
1133520843 16:6555075-6555097 ACATGGAAACACAGGGAAGGAGG + Intronic
1135103635 16:19628119-19628141 ACTTGGGAGGCCAGGGCAGGAGG + Intronic
1135109229 16:19677765-19677787 ACTGGGGAAAACAGAGATAGTGG - Intronic
1136050167 16:27644612-27644634 ACTTGGGAGGGCAAGGCAAGAGG - Intronic
1136074326 16:27806481-27806503 AATTGGGCAGAGAGGAAAAGTGG + Intronic
1138337626 16:56265680-56265702 GCTGGAGAAGTCAGGGAAAGAGG + Intronic
1138925475 16:61585142-61585164 ACTTGGCAAGAGAGGGGAGGAGG + Intergenic
1139829283 16:69783584-69783606 AAATGGGAAGGCAGGGAGAGAGG + Intronic
1140013386 16:71158788-71158810 ACTTGGGAGGCCAAGGTAAGAGG - Intronic
1140199093 16:72879976-72879998 ACTTGTTAGGACAGGAAAAGGGG - Intronic
1140507781 16:75484908-75484930 ATATGTGAAGACAGGAAAAGAGG + Intronic
1141094485 16:81153404-81153426 ACCTGGGAACAGAGGGAAGGAGG - Intergenic
1141094883 16:81156078-81156100 ACCTGGGAAGGGAGGGAAGGAGG - Intergenic
1141847928 16:86623538-86623560 ACTTGGGAAGTCAGTAAATGGGG + Intergenic
1141849038 16:86631447-86631469 ACCAGGGAAGACTGGGAGAGAGG - Intergenic
1142540191 17:652856-652878 GCTTTGGAAGACATGGGAAGGGG + Intronic
1142946828 17:3436559-3436581 ATTTGGGGAGAAAGGGAACGAGG + Intergenic
1143096429 17:4480850-4480872 AGGTGGGAAGGCAGGGAAGGGGG - Intronic
1143121025 17:4606974-4606996 ACTTGGGAAGACAAGGCGTGAGG + Intronic
1143134109 17:4701293-4701315 AATTGAGAAGACTGGGAAGGAGG + Intronic
1143889235 17:10089700-10089722 ACTTGGGGAGAAAGGTAAGGAGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144176556 17:12713128-12713150 ACTTGGGAAGAAAGCCAGAGAGG - Intronic
1144289050 17:13807850-13807872 ACTTGGGAAGAAAGGGCATGTGG - Intergenic
1144575208 17:16425540-16425562 ACTTGGGAGGGCAGCGAAAAAGG - Intronic
1144620958 17:16818239-16818261 ACTGGGGAAGAGGCGGAAAGAGG + Intergenic
1144740325 17:17578388-17578410 ACTTGGGAGGCCAAGGCAAGAGG + Intronic
1145024035 17:19454117-19454139 ACTTGGCAATTCAGGCAAAGTGG - Intergenic
1145368419 17:22286405-22286427 CCTTGGGGACACAGGGAACGGGG - Intergenic
1146005286 17:29156836-29156858 ACAAGGGAGGGCAGGGAAAGGGG + Intronic
1146112533 17:30103074-30103096 ACTTGGGAGGACAAGGCAGGTGG - Intronic
1146533524 17:33630436-33630458 TCCGGGGAGGACAGGGAAAGGGG - Intronic
1146715538 17:35083941-35083963 ACTTGGGAAGCCAGGCACGGTGG + Intronic
1146933720 17:36796749-36796771 ACTAGGGAAGAAAGGTAAAAGGG - Intergenic
1148090572 17:45020489-45020511 ACCTAGGAGGACAGGGGAAGGGG - Intergenic
1148649404 17:49238876-49238898 ATTGGGGAAGGCAGGGAAGGAGG - Intergenic
1148797864 17:50205857-50205879 ACCTGGAAAGAAAAGGAAAGGGG - Intergenic
1149134022 17:53343292-53343314 AGTTGAGAAGGTAGGGAAAGAGG + Intergenic
1149710270 17:58735438-58735460 CTTTGGGAAGACAAGGCAAGAGG - Exonic
1150361075 17:64534567-64534589 TCTTGCTAAGAAAGGGAAAGGGG - Exonic
1151269383 17:72981997-72982019 ACTTGGGAGGCCAAGGCAAGAGG + Intronic
1151605843 17:75135085-75135107 ACTTGGGAAGCCAAGGCAAGAGG - Intergenic
1153027515 18:684966-684988 ACTTTGGAAGATGGGGCAAGAGG - Intronic
1153378572 18:4410148-4410170 ACTTGGGAAGAGTGGGAGAGGGG + Intronic
1153594637 18:6712550-6712572 ACTTGGGAGGGCAAGGCAAGAGG - Intergenic
1153848634 18:9072403-9072425 ACTGGGGAAGGCTGGGGAAGGGG - Intergenic
1154351816 18:13589775-13589797 GTTTGGGAGGAAAGGGAAAGAGG + Intronic
1155256654 18:24003854-24003876 ACTTGGGAAGCTAAGGCAAGAGG - Intronic
1155355134 18:24944488-24944510 GCCTGGGAAAACAGTGAAAGGGG + Intergenic
1155540460 18:26863680-26863702 GCTCGGGAAGTCAGGAAAAGCGG + Intronic
1155602434 18:27564973-27564995 ACTTGGGAGGCCAGGGCAGGCGG - Intergenic
1155653119 18:28164509-28164531 ATCTGGGAAAACAGGGAAGGTGG - Intronic
1156417871 18:36917324-36917346 ACTTGGGAAGCTGGGGAAGGAGG - Intronic
1156711611 18:39953596-39953618 AGTTCTGAAGAGAGGGAAAGAGG + Intergenic
1156740575 18:40322407-40322429 TCTTGGCAAGTCAGGGATAGAGG + Intergenic
1156811020 18:41251615-41251637 ACTTCAGAAGACAGAGAAACAGG - Intergenic
1157006199 18:43587984-43588006 ACTAGAGAAGACAGGAAATGAGG - Intergenic
1157134971 18:45045178-45045200 ACTTGGGAAGCCAAGGCAGGTGG + Intronic
1157265743 18:46219711-46219733 ACTTGGGAGGCCAAGGCAAGCGG - Intronic
1158348107 18:56536200-56536222 ATTTGGGAGGCCAGGGAAGGTGG + Intergenic
1158639138 18:59188412-59188434 ACTGGGGCAGCTAGGGAAAGAGG + Intergenic
1158817327 18:61118237-61118259 ACTTCAGCAGACAGTGAAAGAGG + Intergenic
1158819607 18:61144394-61144416 ATCTGGGAAGGCAGGGACAGGGG - Intergenic
1158881255 18:61781608-61781630 ACTTGGGAAGAGCGGGAGGGGGG + Intergenic
1160075046 18:75666762-75666784 TATTGGGAACACAGGGAAAATGG + Intergenic
1160945683 19:1642714-1642736 ACTTGGGAGGCCAAGGCAAGAGG - Intronic
1161319878 19:3636244-3636266 AGCTGGGCAGACAGGGGAAGTGG + Intronic
1161509960 19:4664789-4664811 GCTTTGGAAGGCAGGGAACGAGG - Intronic
1161798082 19:6399169-6399191 ACTTGGGAAGCTGAGGAAAGAGG + Intergenic
1161913940 19:7214944-7214966 AGCTGGGAAGACAGGGAAGAAGG - Intronic
1162339409 19:10083118-10083140 ACTTGGGAAGCCAAGGCAGGAGG - Intergenic
1162568113 19:11455241-11455263 ACTTGGGAAGCCAAGGCAGGAGG - Intronic
1162995874 19:14334701-14334723 ATGAAGGAAGACAGGGAAAGTGG - Intergenic
1163300831 19:16445041-16445063 TCATGGGAAGCAAGGGAAAGAGG + Intronic
1163458452 19:17422483-17422505 AGTTGGGAGGGCAGGGAAGGTGG - Intronic
1164760661 19:30726155-30726177 ACTTGGTAAGACAAGGACATGGG - Intergenic
1164769473 19:30797143-30797165 ACTTGGGAATTCAGGCAACGAGG + Intergenic
1165575671 19:36815051-36815073 ACTTGGGAGGACATGGTAGGAGG - Intergenic
1165738273 19:38191289-38191311 ACTTGGGAGGCCAGGGTAGGAGG + Intronic
1165888755 19:39098437-39098459 ACCTGGGGAGAAAGGGACAGAGG - Exonic
1165899891 19:39164416-39164438 GCCTGGGAAGTCAGGGAAGGTGG + Intronic
1166202420 19:41246796-41246818 ACTTGGGAGGCCAAGGAAGGAGG - Intronic
1166548523 19:43649309-43649331 CCTTGGGAAGCCAAGGAGAGAGG + Intronic
1167274876 19:48531248-48531270 ACTTGGGAAGCCGGGGAGGGCGG + Intergenic
1167578157 19:50327682-50327704 TCTGGAGAAGGCAGGGAAAGTGG + Intronic
1168057747 19:53872865-53872887 CCTTGGGGAGGGAGGGAAAGAGG + Intronic
1168351172 19:55676806-55676828 ACATGGGAAGACAGGGAGGCAGG - Exonic
925236762 2:2285592-2285614 AATTGGGAAGACCCAGAAAGGGG - Intronic
925537444 2:4932739-4932761 TCCTGGCAAGACAGGGAAGGGGG + Intergenic
925881729 2:8358312-8358334 AGTTGGCAAGACATGAAAAGTGG + Intergenic
926484201 2:13434420-13434442 AATGGGGAAGAGAGAGAAAGAGG - Intergenic
927495870 2:23551403-23551425 ACATGGGAAGGGAGGGAAATGGG + Intronic
927630251 2:24766926-24766948 ATTTGGGAAACTAGGGAAAGGGG + Intronic
928073813 2:28244188-28244210 ACAGGGGAACACAGTGAAAGGGG + Intronic
928217853 2:29377231-29377253 ACTTGGGAAGCCAGGGTGGGCGG + Intronic
928275950 2:29900117-29900139 TCTGGGCAAGACAGGGAAATTGG - Intronic
928415407 2:31087574-31087596 ACTTGGGGAGAGAAGGAAAGAGG + Intronic
928578744 2:32683327-32683349 ACTTGGAGAGACAGGGACAGTGG + Intronic
928873582 2:36011076-36011098 ACTTGGGAAGACCTGGAAAAGGG - Intergenic
928876453 2:36045754-36045776 ACTGGGGAAGCCTGGTAAAGAGG - Intergenic
929505254 2:42523249-42523271 ACTCAGGAAGAAAGGGAGAGTGG - Intronic
929986281 2:46736148-46736170 ACTTGGGAAGTCAAGGCAGGAGG - Intronic
929998527 2:46845573-46845595 ACTTGTGGAGACATGGAAAAAGG - Intronic
930043760 2:47150622-47150644 ACTTGGGAAGCCAGGGCAGGAGG - Intronic
930085054 2:47490789-47490811 AATTGGGAAGAAAGGGTAGGGGG + Intronic
930292721 2:49516017-49516039 TCATGGGATGACAGGGGAAGAGG + Intergenic
930777262 2:55185689-55185711 AATTGGGAAGAGAGATAAAGAGG - Intronic
931169394 2:59786900-59786922 ACAAAGGAAGGCAGGGAAAGAGG - Intergenic
931990695 2:67787166-67787188 ACTTGGAGGGAGAGGGAAAGGGG + Intergenic
932117579 2:69067333-69067355 ACTTGTAAAGAAAGGGAAATAGG + Intronic
932275646 2:70450398-70450420 ACTGGGGAAGAAAGTGAAGGAGG - Exonic
932559854 2:72857568-72857590 ACTTGGGAACACAGGGGACTGGG - Intergenic
932989103 2:76764689-76764711 ACTAAGGGAGACAGAGAAAGTGG + Intronic
933846621 2:86332051-86332073 CCCTGGGAATACAGGGAAAAAGG - Intronic
934621548 2:95812572-95812594 ACTTGAGAAGATAGGCAAACTGG + Intergenic
934811895 2:97286243-97286265 ACTTGAGAAGATAGGCAAACTGG - Intergenic
934825799 2:97421697-97421719 ACTTGAGAAGATAGGCAAACTGG + Intergenic
935580120 2:104749414-104749436 ATTTGGGAAGAAAGGGGGAGAGG - Intergenic
936979996 2:118255500-118255522 ACCTGGGAAGACCAAGAAAGAGG - Intergenic
937068724 2:119044579-119044601 ACTTGGGAAGAGTGGGAGGGGGG - Intergenic
938022353 2:127916378-127916400 ACTTGGGAAGATAAGGGAGGAGG + Intergenic
938128708 2:128692937-128692959 CCTTGGGAAGCCAAGGTAAGTGG - Intergenic
938261168 2:129895989-129896011 AGTTGGTAACCCAGGGAAAGAGG - Intergenic
940541042 2:155018455-155018477 TTTTGGGAGGACAAGGAAAGAGG - Intergenic
940851426 2:158691049-158691071 GCTGGGGAGCACAGGGAAAGAGG + Intergenic
941109003 2:161396782-161396804 ACTTGGGATGTCAGGATAAGAGG + Intronic
941209606 2:162621014-162621036 CATTTGGAAGTCAGGGAAAGAGG - Intronic
941849131 2:170161590-170161612 AGTGGGGAAGAAAGGGAAGGAGG - Intergenic
942499039 2:176568894-176568916 ACTTTGGAGGACAGAGTAAGGGG - Intergenic
942962312 2:181845912-181845934 ACTTTGGAAGGCAAGGCAAGAGG - Intergenic
943273666 2:185841126-185841148 AATGGAAAAGACAGGGAAAGGGG + Intergenic
944044509 2:195393285-195393307 ACTTTGGAAGACAGTGCAAAGGG - Intergenic
944452853 2:199860528-199860550 ACTTGGGAGGGCAAGGCAAGAGG - Intergenic
944986174 2:205180098-205180120 ACTTTGGAAGAAAGAGAAACAGG - Intronic
946212519 2:218158523-218158545 ACTTTGGAAGACAAGGAGAGGGG + Intergenic
946347043 2:219119044-219119066 GCAGAGGAAGACAGGGAAAGTGG - Intronic
946378126 2:219326572-219326594 ACTTTGGGAGGCAGGGCAAGGGG - Intergenic
946607855 2:221425422-221425444 GCCTGGAAAGAAAGGGAAAGTGG - Exonic
946733724 2:222733626-222733648 ATTTGGGTAAACAGGTAAAGAGG - Intergenic
947300060 2:228678976-228678998 ACTTGGGAGGTCAAGGCAAGTGG + Intergenic
947971865 2:234331546-234331568 ACGTGGGGAGGGAGGGAAAGAGG - Intergenic
948788449 2:240365126-240365148 ATTTGGGAAAACGGGAAAAGAGG + Intergenic
948840940 2:240648540-240648562 CCTGGGGAAGACAGTGAATGGGG + Intergenic
1168911938 20:1455258-1455280 AGTTGGGAACACATGGAAGGAGG + Intronic
1169902440 20:10567159-10567181 ACTTTGGCAGCTAGGGAAAGAGG + Intronic
1170350476 20:15435527-15435549 ACTGGGGAGGACAGGGAACATGG - Intronic
1170792572 20:19520301-19520323 ACTTGGGAATTCAGGCAGAGGGG + Intronic
1171225643 20:23439981-23440003 ACATGTGAAGGCAGGGAGAGGGG + Intronic
1172325271 20:34029580-34029602 AATGGGGAAGAGAGAGAAAGAGG + Intronic
1172813609 20:37669449-37669471 AGGTGAGAAGACAGGGAAAAAGG - Intergenic
1173219038 20:41116140-41116162 AAGTGGGAAGTTAGGGAAAGAGG - Intronic
1173663815 20:44751750-44751772 ATCTGGGAAGCCAGGGGAAGTGG - Exonic
1175301805 20:57948231-57948253 GTCTGGGAAGAAAGGGAAAGAGG + Intergenic
1176646734 21:9358410-9358432 ACTAAGAAAGACAGGGAAAATGG - Intergenic
1178281247 21:31284888-31284910 ACATGGGAAGTCAGGGAAAAAGG + Intronic
1178880005 21:36441930-36441952 ACTTGGGCTGAGAGGGAAACAGG - Intergenic
1179162871 21:38912317-38912339 CCTTGGGAAGAAAGGCTAAGTGG + Intergenic
1179177496 21:39019662-39019684 ACCTGGTAGGGCAGGGAAAGTGG - Intergenic
1179250863 21:39670148-39670170 AGATAGGGAGACAGGGAAAGTGG - Exonic
1179388611 21:40966780-40966802 AATGGAGAAGACAGGCAAAGAGG - Intergenic
1179715492 21:43285159-43285181 ACATGAGAAGACAGCCAAAGAGG + Intergenic
1180060440 21:45382276-45382298 ACTGAGGAAGACAGAGCAAGGGG + Intergenic
1180885042 22:19236701-19236723 ACTTGGGAAGCCAAGGCAGGAGG + Intronic
1181025303 22:20124303-20124325 CCCTTGGTAGACAGGGAAAGTGG + Intronic
1182132099 22:27862045-27862067 CCGTGTGAAGACAGGGACAGTGG - Intronic
1182258176 22:29053083-29053105 ACATGGGAAGAACGGGACAGGGG - Intronic
1182374289 22:29835151-29835173 ACTTGGGAAGCCAAGGCAGGAGG + Intronic
1182887287 22:33786160-33786182 TGCTGGGAAGACAGGGAAGGTGG + Intronic
1183054501 22:35295312-35295334 AATTGGGAATACAGAGAAACAGG + Exonic
1183213487 22:36465138-36465160 GGTTGGGAAGCCGGGGAAAGGGG - Intergenic
1183356753 22:37363868-37363890 GGTTGGGAAGACAGTGACAGCGG + Intergenic
1184143734 22:42595892-42595914 AGTTGGGAAGTCTGGGAAAAAGG - Intronic
1184995043 22:48199269-48199291 CCTGGGGAAGACAGTGGAAGAGG + Intergenic
949233413 3:1778089-1778111 ACTTGGGCACACAAGGAATGAGG - Intergenic
949280167 3:2336717-2336739 ACTTAGGAAGTCAGGAAATGTGG + Intronic
949764922 3:7515896-7515918 ACTTTGGGAGACAGAGACAGGGG + Intronic
949936310 3:9118927-9118949 CATAGGGAGGACAGGGAAAGGGG - Intronic
950151715 3:10692698-10692720 AGTTGGGAGGACAGGGAAGCAGG - Intronic
950232998 3:11293050-11293072 ACTAGGAAATACAGAGAAAGGGG + Intronic
950324164 3:12089564-12089586 ACTTGGGAAGCCAAGGCAGGGGG + Intronic
950776911 3:15358019-15358041 ACTTGGGAGGCCGAGGAAAGAGG + Intergenic
950796134 3:15512005-15512027 ACCCGGGAAGACAGGGAATGGGG - Intronic
950924004 3:16722007-16722029 ATTTGGAAACACAGGGAAAGGGG + Intergenic
951299806 3:20982078-20982100 AGTAGAGAAAACAGGGAAAGAGG + Intergenic
951895180 3:27603249-27603271 ACTTGGGAGGCCAGGGCAGGAGG - Intergenic
952267336 3:31799296-31799318 ACTTGAGAAGCCAGGGCGAGAGG + Intronic
952305730 3:32144533-32144555 ACTTGGTGTGACAGAGAAAGGGG + Intronic
953399261 3:42598727-42598749 ACTTGGGAAAAGAGGGAAATGGG + Intronic
953490990 3:43350772-43350794 ACTTTTGAAGACAGGTTAAGGGG - Exonic
954040100 3:47879496-47879518 ACTTGGGGAGACTGGGTAAAAGG - Intronic
954483054 3:50819716-50819738 ATTTGGGAAGCCAGGGCAGGTGG + Intronic
954485421 3:50846144-50846166 ACTTTGGAGGACAGAGAAAGAGG + Intronic
954740067 3:52742312-52742334 ACTTGGGAGGCCAAGGAAGGAGG - Intronic
954896543 3:53979806-53979828 CCTTGGGAAGACAAGGCAGGAGG - Intergenic
955242126 3:57187370-57187392 ATTTGGGAAGCCAGGAAGAGCGG - Intergenic
955419204 3:58720041-58720063 AGATGGCAAGACAGGGAAGGTGG - Intronic
955832640 3:63020593-63020615 AAATGGGAAGAGAGGGAAAGAGG + Intergenic
955846984 3:63174634-63174656 ACTTTGGAAGACAGCAAGAGAGG + Intergenic
956103542 3:65793127-65793149 GCTTGGGAAGACAGGGATGTTGG + Intronic
956683418 3:71802810-71802832 AGTTGGGGAGTCAGGGGAAGGGG + Intergenic
956780539 3:72599772-72599794 ACTGGGAAAGAAAGGGACAGGGG - Intergenic
956972408 3:74541987-74542009 ACTTGGGAAGCCAAGGCAGGAGG + Intergenic
958432068 3:94052415-94052437 ACATGGGCAGTTAGGGAAAGTGG + Intronic
958720148 3:97833932-97833954 ACTTGGGAAGAAAGGAAACAAGG + Intronic
958933883 3:100237294-100237316 ACTTGGGAAGCCAAGGAAGAAGG + Intergenic
959301843 3:104612418-104612440 CCTTGGGCAGACAGCCAAAGAGG - Intergenic
960430258 3:117560181-117560203 TCTTGGGAAGGAAGAGAAAGTGG + Intergenic
960444790 3:117734431-117734453 ACTAGGGAAGAGAAGGAAATGGG + Intergenic
960939407 3:122923580-122923602 GTGTGTGAAGACAGGGAAAGAGG + Intronic
961735624 3:129000926-129000948 ACTGGGAAAGAGAGGGAAACAGG - Intronic
962168209 3:133073270-133073292 ACTTGGGAAAACGGGGAACTGGG - Intronic
962498881 3:135968699-135968721 CCTTTGGAAGACAGGGAAAATGG - Intronic
963029323 3:140951940-140951962 ACTTGGGAGGTCAAGGTAAGAGG - Intronic
963070862 3:141304183-141304205 ACTCGAGAAAAAAGGGAAAGTGG + Intergenic
963397529 3:144752754-144752776 TCTTGGGAAAACAGATAAAGAGG + Intergenic
963704183 3:148665369-148665391 CCCTGGGAAGACAGGGAACGAGG - Intergenic
964716552 3:159728591-159728613 ACTGGGAAAGAGAGGGAAAGGGG - Intronic
964716727 3:159730771-159730793 ACTGGGAAAGAGAGGGAAAGGGG - Intronic
964742750 3:159984597-159984619 CTTTGGGAAGCCAAGGAAAGTGG - Intergenic
964760355 3:160129842-160129864 TGCAGGGAAGACAGGGAAAGAGG - Intergenic
965633705 3:170759446-170759468 ACATGGGAAGACAGGGCTAATGG - Intronic
965671335 3:171150893-171150915 ATTAAGGAAGACAGGGAATGGGG + Intronic
966143996 3:176788929-176788951 ACAAGGGAAGACAAGGCAAGGGG + Intergenic
966548527 3:181179236-181179258 CCTTGGGCAGTCACGGAAAGAGG - Intergenic
966581788 3:181575698-181575720 CCTTGGGAGGCCAGGGCAAGCGG + Intergenic
966982296 3:185149147-185149169 ATTTGGGAAGCCAAGGCAAGCGG + Intronic
967596710 3:191333504-191333526 ATTTTGAAAAACAGGGAAAGTGG - Intronic
967793482 3:193573545-193573567 ACCTGAGAAGGCAGGGAAGGAGG - Intronic
967835729 3:193960794-193960816 ACAAGGGAAGAAAGGCAAAGGGG + Intergenic
1202740152 3_GL000221v1_random:46630-46652 ACTAAGAAAGACAGGGAAAATGG + Intergenic
968878589 4:3287044-3287066 ACTGAGGAAGACAGAGAAAAAGG + Intergenic
968910622 4:3475484-3475506 ACCTGGGAAGACAGGGGAGGTGG + Intronic
969539801 4:7780567-7780589 ACTTGGGAGGCCAAGGAAGGAGG + Intronic
970031570 4:11681476-11681498 AGTTGGAAAGAAAGAGAAAGAGG + Intergenic
970049754 4:11900389-11900411 AAATGGGAAGAAGGGGAAAGAGG - Intergenic
970128334 4:12839476-12839498 ATTTGGGAAGACAGGAAGAGTGG + Intergenic
970736770 4:19179658-19179680 ATTTGGGAAGCCAAGGAAACCGG + Intergenic
970949620 4:21738751-21738773 AGTGGGGAAGACAGGGGAAATGG - Intronic
970955214 4:21803016-21803038 ACTAGGGAAGACATGGAACTGGG - Intronic
971545691 4:27882200-27882222 AGTTGGGAAAACAGGGAAACTGG - Intergenic
972635214 4:40878020-40878042 ACTTGGCAAGACAGGGTGGGTGG + Intronic
972637024 4:40893409-40893431 ACACTGGAAGACAGTGAAAGAGG + Exonic
977258312 4:94764888-94764910 ATTTGGGAGGACTGGGAAGGGGG + Intronic
979188109 4:117824250-117824272 ACTTTGGAAGAGAGGCAGAGAGG + Intergenic
979233069 4:118368395-118368417 CCTTGGGAAGACAGGGTGGGAGG + Intergenic
979541985 4:121894670-121894692 ACTTGGGAAGATGGGGTAGGAGG - Intronic
979806268 4:124975717-124975739 ACTTGGGAAAAAAAGGAAAAAGG - Intergenic
980059038 4:128109117-128109139 ATTTGGGAATTCATGGAAAGAGG - Intronic
982176881 4:152714274-152714296 GCCTGGAGAGACAGGGAAAGTGG - Intronic
982222629 4:153137955-153137977 ACTTGGGAGGCCAAGGAAGGAGG + Intergenic
982292655 4:153793902-153793924 AGTTGGGAAGAAAGGGACAGGGG - Intergenic
982477704 4:155873313-155873335 ACTTGGGGATACAAGGAAGGAGG - Intronic
983199227 4:164843043-164843065 CTTTGGGAAGCCAAGGAAAGTGG + Intergenic
983570920 4:169207316-169207338 ACTTGGGAAGCTAAGGCAAGAGG + Intronic
984226288 4:177039306-177039328 ACTTGGGAAGAAAAGGAATGAGG - Intergenic
984890051 4:184483815-184483837 ACTTGGGAGGCCAAGGCAAGAGG + Intergenic
985280310 4:188280007-188280029 ACTTGGGAAGTCTGGGCAGGAGG + Intergenic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
987027190 5:13939514-13939536 CTGTGGGAAGACAGGGAAACAGG - Intronic
987947897 5:24637188-24637210 ACTTGGGAAGACAGGGAAAGAGG - Intronic
988271265 5:29020753-29020775 GCTTGAGAAAGCAGGGAAAGAGG - Intergenic
988394172 5:30675781-30675803 AAATGGGAAGGGAGGGAAAGTGG + Intergenic
988587453 5:32520162-32520184 ATTTGGGAGGCCAGGGAAGGAGG - Intergenic
988800890 5:34695924-34695946 ATTTGGGAGGCCAGGGCAAGAGG - Intronic
989558082 5:42820252-42820274 ACATTGGAAGGCAGGGAGAGTGG + Intronic
990134240 5:52626111-52626133 AAATGGGAAGACAGGACAAGAGG - Intergenic
990746842 5:58967256-58967278 ATGTGGGAACACAGGGAAAGAGG - Intergenic
991080131 5:62589558-62589580 ACATGGGAATAAAGAGAAAGGGG - Intronic
991572240 5:68067301-68067323 AATTGTGAAGACAGGGAGAAGGG + Intergenic
991728994 5:69564018-69564040 ACTTGGGAGGCCAAGGCAAGTGG - Intronic
991805425 5:70419165-70419187 ACTTGGGAGGCCAAGGCAAGTGG - Intergenic
991865960 5:71063857-71063879 ACTTGGGAGGCCAAGGCAAGTGG + Intronic
991906078 5:71512543-71512565 TTTTGGGAAGACTGGGAGAGAGG + Intronic
992085158 5:73271586-73271608 ATGGGGGAAGACTGGGAAAGAGG + Intergenic
992878243 5:81079076-81079098 ACTTGGAAAGACACAGAAGGCGG - Intronic
994326256 5:98449066-98449088 ACTTAGGAAGACAGCAAGAGAGG + Intergenic
994489108 5:100419166-100419188 ATTTGGGTAGACAGGGCAAAGGG + Intergenic
995279682 5:110319046-110319068 GCTTGGAAAGGCAGGGAATGGGG + Intronic
996305512 5:122042493-122042515 CTTTGGGAAGCCAAGGAAAGAGG - Intronic
996521339 5:124429327-124429349 ACAAAGGAAGACAGGAAAAGAGG + Intergenic
998102494 5:139445881-139445903 CTTTGGGAAGTCAGGGCAAGAGG + Intergenic
998270169 5:140699456-140699478 TCTTGAGGAGACAGGGAAAGAGG - Intronic
998600878 5:143583746-143583768 ACAGGGGAACATAGGGAAAGAGG - Intergenic
998937085 5:147240836-147240858 AAATGGGAAGAGAGGGAAAAAGG - Intronic
999212238 5:149899930-149899952 ACATAGGAAGTCAGGGCAAGAGG - Intronic
999770952 5:154775063-154775085 CTTTGGGAAGCCAGGGCAAGAGG + Intronic
1000638407 5:163670530-163670552 AGATAGGAAGACAGGAAAAGTGG - Intergenic
1001088020 5:168715632-168715654 ACTTAGGAAAACAGGGCGAGAGG + Intronic
1001108374 5:168875146-168875168 AGGAGGGAAGAGAGGGAAAGAGG + Intronic
1001638913 5:173231761-173231783 GCTTGGGAGCACAGGGAAGGCGG + Intergenic
1003254681 6:4464646-4464668 TCTTTGGAAAAGAGGGAAAGAGG - Intergenic
1003610566 6:7611142-7611164 ACATGGGAGGCCAGGGCAAGAGG - Exonic
1003658669 6:8039816-8039838 AGTTGGGAAGACAGGGGTATGGG + Intronic
1003668018 6:8129584-8129606 AGTTAGGAAGGCAGTGAAAGGGG + Intergenic
1003874309 6:10422903-10422925 ACTGTGGGAGACAGGGGAAGAGG - Intergenic
1004016237 6:11734525-11734547 ATTTGGGTACTCAGGGAAAGAGG + Intronic
1004313630 6:14567281-14567303 AGATGAGAAGACAGGGATAGAGG + Intergenic
1004694700 6:18022748-18022770 AGTTGGGAACACAGGAACAGTGG + Intergenic
1005031289 6:21511578-21511600 ACTTGGGAGGTCAAGGGAAGAGG - Intergenic
1005707967 6:28475208-28475230 ACTTGGCAAGACAGGGGAATCGG + Intergenic
1006020395 6:31114482-31114504 ACTGGAGAAGAGAGAGAAAGTGG - Intergenic
1006401667 6:33821409-33821431 CATGGGGAAGAGAGGGAAAGCGG - Intergenic
1006755097 6:36408770-36408792 ACTTGGGAAGCCAAGGTGAGAGG + Intronic
1006816888 6:36857557-36857579 ACTTGGGAAGCCAAGGAGGGAGG - Intronic
1006990387 6:38210063-38210085 ACGTGGGGAGACAGGGGAAGGGG + Intronic
1007422382 6:41727581-41727603 ACTTGGGAAGCTAAGGTAAGAGG + Intronic
1008255699 6:49297219-49297241 ACATTGGCAGACAGAGAAAGTGG + Intergenic
1008607888 6:53158236-53158258 ACTTGTGAAGAAAGGCAAATAGG + Intergenic
1009602206 6:65816139-65816161 ACTTAGGCAGACAAAGAAAGAGG + Intergenic
1009848961 6:69171669-69171691 CCAGGGGAAGACAGGGAATGAGG - Intronic
1009930925 6:70176771-70176793 ACTTGGGAAGAAAATAAAAGAGG - Intronic
1009981437 6:70730298-70730320 ACTTGGGAAGCCAAGGTGAGAGG - Intronic
1010283522 6:74048093-74048115 ACATTGGAAGGCTGGGAAAGTGG + Intergenic
1010726997 6:79346448-79346470 AATTGTAAAGACAGGGAAACTGG - Intergenic
1011403385 6:86989244-86989266 ACTCAGGAAGACAGGCAAAAAGG - Intronic
1011699149 6:89939771-89939793 ACTTGGGAGGCCAAGGCAAGAGG - Intronic
1011936352 6:92783113-92783135 ACTACGGAAGACAGGGATCGTGG + Intergenic
1013601126 6:111705890-111705912 ACTTGGGAGGCCAGGGCGAGAGG - Intronic
1013666873 6:112358396-112358418 ACTTGGGAGGACGAGGCAAGCGG + Intergenic
1014306263 6:119746630-119746652 ACTAGAGTAGAAAGGGAAAGAGG - Intergenic
1014309891 6:119786915-119786937 ATTTGGGAAGATGGGGAAAAGGG + Intergenic
1014581335 6:123141110-123141132 AGTAGGGTAGACGGGGAAAGGGG - Intergenic
1014623402 6:123697211-123697233 GCTAGGTAAGGCAGGGAAAGTGG - Intergenic
1014646668 6:123982307-123982329 AATTGTGAAGACACGCAAAGAGG + Intronic
1014897006 6:126913684-126913706 AGGGGGGAAGACAGAGAAAGAGG + Intergenic
1014987445 6:128029208-128029230 ACTTGGCAAGAGAGGGAGACAGG - Intronic
1016206203 6:141471637-141471659 ATTTGGAAAGAGAGGAAAAGTGG + Intergenic
1016988647 6:149913554-149913576 AGGAGGGAAGACAGGGAAGGAGG + Intergenic
1017502603 6:155039365-155039387 TCAGGGGAAGACAGAGAAAGGGG - Intronic
1018292523 6:162307154-162307176 ATTTGGGAAGCCAAGGCAAGTGG + Intronic
1019455344 7:1123882-1123904 GCCTGGGAAGCCAGGGAATGCGG - Intronic
1019749547 7:2720304-2720326 ACGTGGGGAGACATGGAAACGGG - Intronic
1020556062 7:9671490-9671512 ACTTAGGAAGCTAGGGCAAGAGG - Intergenic
1020677513 7:11198704-11198726 ACATCAGAAGACAGGGAAAGGGG - Intergenic
1020866027 7:13563834-13563856 AGTTGAGAACACAGGGGAAGAGG - Intergenic
1021125219 7:16844415-16844437 ACTTGGGATGTCAGGGACACCGG - Intergenic
1021335946 7:19402739-19402761 ACTTTGGAAGACTGGCAAAATGG - Intergenic
1021343454 7:19491664-19491686 ACTTTAGAAAAAAGGGAAAGTGG - Intergenic
1021744988 7:23731126-23731148 ACTTTGGAAGGCAGAGACAGGGG - Intronic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1021932012 7:25590334-25590356 ACTGGGAAATACAGGGAAAAAGG + Intergenic
1022120653 7:27304989-27305011 ACATGGGCAGACTGGGAACGTGG - Intergenic
1023172406 7:37402469-37402491 ACTTAGGAAGAAAGAGGAAGGGG - Intronic
1023312689 7:38903603-38903625 TGTTGGGAAGACAGAGAAGGTGG - Intronic
1023369264 7:39496731-39496753 ACTTGGAGAGACAGGAGAAGTGG - Intergenic
1023378777 7:39585431-39585453 ACGTGAGAACACAGGGAAAGCGG + Intronic
1023789631 7:43743297-43743319 ACCTGGGAAGCCAAGGTAAGCGG + Intergenic
1023803436 7:43854449-43854471 ACTTGGGAGGCCAAGGAAGGAGG - Intergenic
1024396423 7:48874034-48874056 GGAGGGGAAGACAGGGAAAGAGG + Intergenic
1025193430 7:56913652-56913674 ACTTTGGAAGACAAGGCAGGAGG + Intergenic
1025678511 7:63663277-63663299 ACTTTGGAAGACAAGGCAGGAGG - Intergenic
1025951105 7:66146118-66146140 ACTTGGGGAGCCAGGGAGAATGG - Intronic
1026674900 7:72420225-72420247 ACTTGGGAAAAGAAGGACAGAGG + Intronic
1026685309 7:72504629-72504651 ACCTGGAAATACAGGGAAAAAGG + Intergenic
1026997217 7:74625539-74625561 ACTCTGGAAGACAGCGAATGTGG + Intergenic
1027424842 7:78052112-78052134 ACTTGGGAGGCCAGGGTGAGTGG - Intronic
1028637145 7:93002050-93002072 ACTTGGGGAGAAAGGGAAGAAGG - Intergenic
1028901887 7:96110607-96110629 CCAAGTGAAGACAGGGAAAGAGG - Intergenic
1029056203 7:97745558-97745580 CTTTGGGAAGCCAGGGAAAAAGG + Intergenic
1029169058 7:98617951-98617973 ACTCGGGAGGATGGGGAAAGGGG + Intronic
1029244723 7:99190754-99190776 ACTTGGGAAGGCAAGGCGAGAGG - Intronic
1029803442 7:102974004-102974026 GCTCGGGAAAACAGGGAAAAAGG - Intronic
1030259681 7:107550005-107550027 ACAGGGGAAGAGAGAGAAAGAGG - Intronic
1030823367 7:114123104-114123126 ACTTGGGGAGGCTGAGAAAGGGG + Intronic
1030896342 7:115065521-115065543 ACTTGGGAAGCTAAGCAAAGAGG - Intergenic
1031097418 7:117437152-117437174 AAGTGGGATGATAGGGAAAGGGG + Intergenic
1032082911 7:128869100-128869122 ATTTCGGAGGCCAGGGAAAGGGG + Intronic
1032142316 7:129343474-129343496 ACTTAAGAAGAAAGGGAGAGGGG + Intronic
1032223687 7:130013182-130013204 AATTAGGAAGAGAGGGAAACAGG - Intergenic
1032441122 7:131943845-131943867 ACTTGAGAAAACAGGGCTAGTGG - Intergenic
1032791816 7:135248004-135248026 ATTTGGAAAGTCAGGGCAAGGGG - Intronic
1032949574 7:136892114-136892136 AATTTGAAAGACAAGGAAAGAGG + Intronic
1033333351 7:140433070-140433092 ACCTGGGAAGAGGTGGAAAGGGG + Intergenic
1033636548 7:143217507-143217529 ACTTGGGGCAACAGGAAAAGTGG - Intergenic
1034180720 7:149135502-149135524 ACTTGGGAAGACTGGGAGCAGGG + Intronic
1034543016 7:151771296-151771318 ACTTGGAAAGACAAGAAACGTGG - Intronic
1034679703 7:152919312-152919334 ACTTTGGGAGACCGAGAAAGTGG - Intergenic
1034691025 7:153013747-153013769 ACACGGGAAGGAAGGGAAAGTGG + Intergenic
1035110245 7:156475793-156475815 ACGTGGGAAGCAAGGGAAATGGG - Intergenic
1035990498 8:4484659-4484681 ACCTGGGAAGATATTGAAAGAGG + Intronic
1036069570 8:5425771-5425793 ACTTGGGAAAACAGGGATGAGGG - Intergenic
1036216260 8:6882626-6882648 ACTTGGGAAGACCCAGGAAGGGG + Intergenic
1037139950 8:15507763-15507785 ACTTGGGAAAAGAGAGAGAGAGG + Intronic
1037270140 8:17117851-17117873 ACTTGGGAGGCCAAGGCAAGAGG - Intronic
1037381778 8:18292832-18292854 CCTTGGGAATACAGAGAAATTGG + Intergenic
1037619121 8:20547658-20547680 ACTGGGGAGGGCATGGAAAGGGG + Intergenic
1037691591 8:21185647-21185669 ACATGGAAGCACAGGGAAAGAGG - Intergenic
1037743862 8:21628139-21628161 TCTGGGGAAGACAGGGAAGCAGG - Intergenic
1038415312 8:27390530-27390552 ACTTGGGAGGCCAAGGCAAGAGG + Intronic
1038429707 8:27490765-27490787 ACTTGGAATGCCTGGGAAAGAGG - Exonic
1038721292 8:30038324-30038346 CCTTGGGAAGCTAGGGCAAGAGG + Intergenic
1038875287 8:31542032-31542054 AATTGGGAAGAGGGGAAAAGTGG + Intergenic
1038931985 8:32203603-32203625 CTTTGGGAAGACAAGGAAGGTGG - Intronic
1039028146 8:33280679-33280701 AGCTGGGAAGACAGGGGATGTGG - Intergenic
1039264033 8:35805149-35805171 ATTTGGGAAGACTGGGAGATGGG + Intergenic
1039359769 8:36863380-36863402 ACTTGGGTGGGCAGGGGAAGAGG + Intronic
1039470499 8:37810604-37810626 ACTTGGGAGGACGAGGCAAGAGG - Intronic
1039525743 8:38214535-38214557 ACTTGGGAAGCCAAGGAGGGAGG - Intergenic
1039539642 8:38353596-38353618 GCTAGAGAAGACAGGAAAAGGGG - Intronic
1040515480 8:48130860-48130882 ATTTGGGAGGAGAGGGAGAGAGG + Intergenic
1040901045 8:52417384-52417406 AGTTGGGGAAAGAGGGAAAGGGG + Intronic
1041081779 8:54221424-54221446 ACGTGGGAAGTCAGGGAGTGGGG - Intergenic
1041572299 8:59351375-59351397 ATTTGGGAAGCAAGAGAAAGAGG - Intergenic
1042554357 8:70021764-70021786 CTTTGGGAAGATATGGAAAGTGG - Intergenic
1043803722 8:84644201-84644223 ACTAGGGAAAAAAGGGAAAAGGG + Intronic
1045161391 8:99549917-99549939 ACTTGGGAGGCCCAGGAAAGAGG - Intronic
1046175384 8:110569196-110569218 ACTAGGAAAGACAGGTAAAAAGG + Intergenic
1047010481 8:120667600-120667622 ACTTTGGAGGCCAAGGAAAGAGG - Intronic
1048610983 8:136022778-136022800 TCAGGGGAAGACAGGGAATGGGG + Intergenic
1048717026 8:137282086-137282108 GCTTGGGAGAACAGGGAAAAAGG - Intergenic
1049630775 8:143655414-143655436 ACTTGGGAGGCTAAGGAAAGAGG - Exonic
1049713749 8:144079713-144079735 ACTTGGGTTGGCAGGGAATGGGG + Intronic
1049833570 8:144718226-144718248 ACTTGGGAAGGAAGGAAGAGAGG - Intergenic
1049854894 8:144855244-144855266 ACTAGGCAAGACAGGGGGAGAGG + Intergenic
1052604692 9:30684188-30684210 ACTAGAGAAGGCAGAGAAAGAGG + Intergenic
1054828670 9:69599060-69599082 GGCTGGGAAGAGAGGGAAAGGGG + Intronic
1054843849 9:69771624-69771646 ACTTGGGAAGCCAAGGAAGGTGG - Intergenic
1055435152 9:76285405-76285427 ACTTGAGAAGAGAGTGAGAGAGG + Intronic
1055657144 9:78462310-78462332 ACATGGGAACACAGGAGAAGGGG + Intergenic
1056238822 9:84623171-84623193 ACGTCAGAAGACAGGGAAAGGGG - Intergenic
1056296503 9:85198513-85198535 ACATGTGAAGACACAGAAAGAGG - Intergenic
1056545713 9:87611696-87611718 ACTTGGGAGGACAGGGTGAGAGG - Intronic
1056650019 9:88451230-88451252 ACTTGGGAAGAGACAGAAGGAGG - Intronic
1056712200 9:89000215-89000237 ATTTGGGAACACAGCGAGAGAGG - Exonic
1056738020 9:89226202-89226224 ACTTGGGGAGACAGGGGACAGGG - Intergenic
1057173742 9:92978875-92978897 ACTTGGGAAGCCAAGGCAGGAGG - Intronic
1057292914 9:93818610-93818632 AAGAGGGAAGAAAGGGAAAGAGG + Intergenic
1057554151 9:96074164-96074186 GCTTGGGAAGCCAGGGCCAGAGG - Intergenic
1057701537 9:97366393-97366415 ACACGGGCAGACAGGGAAGGAGG + Intronic
1057809139 9:98244172-98244194 ACTTGGAAAGACAGGTCAGGTGG + Intronic
1058730607 9:107846378-107846400 AGTTGGGAAGAGAGGCAGAGAGG + Intergenic
1059384300 9:113952135-113952157 ACTTGTGAAGCCAGGAAGAGGGG + Intronic
1060110090 9:120900808-120900830 ACTTGGGAAGCCAAGGCAGGAGG - Intergenic
1060982331 9:127800565-127800587 CCCTGGGGAGACAGGGAAGGAGG + Intronic
1061270904 9:129541541-129541563 ACTTTGCAAGACAGGAAGAGTGG + Intergenic
1062705093 9:137934366-137934388 ACTTGTTAAAACATGGAAAGAGG - Intronic
1062708306 9:137957362-137957384 ATTTTGGAAGAAAGGGAAAGCGG + Intronic
1203708793 Un_KI270742v1:76587-76609 ACTAAGAAAGACAGGGAAAATGG + Intergenic
1186206717 X:7208499-7208521 ACTGGAGAAGACAGGGTAAAGGG - Intergenic
1186228762 X:7429809-7429831 TCTGAGGAAGCCAGGGAAAGAGG + Intergenic
1186371683 X:8953308-8953330 ATTTGAGAACACAGCGAAAGAGG - Intergenic
1186414143 X:9368940-9368962 ATTTGGGAGGCCAGGGCAAGAGG + Intergenic
1187000752 X:15174723-15174745 GACTGGGAAGAAAGGGAAAGGGG + Intergenic
1187408165 X:19023034-19023056 GCTTGGGAAAAGAAGGAAAGAGG - Intronic
1187520518 X:20009750-20009772 ACTTGGGAGGCCAAGGAGAGAGG + Intronic
1187833846 X:23410598-23410620 CCAGAGGAAGACAGGGAAAGGGG - Intergenic
1188170930 X:26925201-26925223 ACTTAGCAAAACAGAGAAAGAGG + Intergenic
1188350524 X:29125016-29125038 ATTAGAGAAGACAGGGAAAGAGG + Intronic
1188669125 X:32861700-32861722 CCTTGGTAAGAGAGGGAGAGAGG - Intronic
1189090240 X:38074492-38074514 ACTTGGGAGGCCAAGGCAAGAGG - Intronic
1189284447 X:39841418-39841440 ATTAGGGAAGAAAGGGAGAGGGG + Intergenic
1190279709 X:48921699-48921721 CCTAGGGAGGACAGGCAAAGAGG + Intergenic
1190363281 X:49668673-49668695 ACCTGTGGAGACAGGGAAAAGGG - Intergenic
1190406245 X:50090575-50090597 ATGGGGGAAGACAGGGAAGGGGG + Intronic
1190762797 X:53450675-53450697 CCTTGGGAAGACTGGCAGAGGGG + Intergenic
1190949596 X:55130251-55130273 ACTTGGGAGGACTGGGGCAGAGG + Intronic
1192335997 X:70220318-70220340 ACTGGGGAAAACAGGAAAACTGG - Intergenic
1192496533 X:71620021-71620043 ACTAGGGGAGAGAGAGAAAGAGG - Intergenic
1193122451 X:77837981-77838003 ACTTGGGAAGCCAAGGCAGGTGG - Intronic
1193237314 X:79123648-79123670 AAATGGGAAGAAAGGGAAAGGGG + Intergenic
1195706459 X:107741313-107741335 ACTAAGAAAGAAAGGGAAAGGGG - Intronic
1195768193 X:108319131-108319153 ACTTGGGAAGCCAAGGCAGGGGG + Intronic
1195970019 X:110462884-110462906 AAGAGGGAAGAGAGGGAAAGTGG + Intergenic
1195991285 X:110684953-110684975 ACTTGAGCAGAGTGGGAAAGTGG + Intronic
1196135608 X:112206571-112206593 ACTTTAGAAGCCAGGGAAAGGGG - Intergenic
1196889003 X:120274567-120274589 TCTGAGGAAGACAGGGAGAGTGG - Intronic
1197220092 X:123903996-123904018 GGTTGGGAAGAGAGGGAATGGGG - Intronic
1197323458 X:125062861-125062883 AATTGACAAGACAGGGAAATGGG + Intergenic
1197627537 X:128819405-128819427 TTTTGGGAAGAGAAGGAAAGGGG - Intergenic
1197695167 X:129541624-129541646 TCTTGGGCACACAGGGATAGGGG - Intronic
1198202478 X:134435787-134435809 ACTTGGGAACACAGGTACAAGGG - Intergenic
1198990096 X:142503506-142503528 ACTAGGTAAGAATGGGAAAGGGG - Intergenic
1199345585 X:146734858-146734880 TCTTGGGGAGGCAGGGGAAGTGG - Intergenic
1199771999 X:150981085-150981107 CCTTGTGGAGACAGGGGAAGAGG + Intronic
1199854929 X:151752301-151752323 CCTAGGGAAGCCAAGGAAAGAGG - Intergenic
1200761604 Y:7044085-7044107 ATGGGGCAAGACAGGGAAAGGGG - Intronic
1200986806 Y:9309625-9309647 CTTTGGGAAGCCAGGGAAGGAGG + Intergenic
1201579090 Y:15492431-15492453 ATTTGGGAGGCCAGGGAAGGAGG + Intergenic
1201596971 Y:15680973-15680995 TCTGAGGAAGCCAGGGAAAGGGG + Intergenic
1202118874 Y:21504195-21504217 CTTTGGGAAGCCAGGGAAGGAGG - Intergenic
1202121326 Y:21527735-21527757 CTTTGGGAAGCCAGGGAAGGAGG - Intronic
1202123778 Y:21551275-21551297 CTTTGGGAAGCCAGGGAAGGAGG - Intergenic
1202155230 Y:21878105-21878127 CTTTGGGAAGCCAGGGAAGGAGG + Intergenic
1202157677 Y:21901647-21901669 CTTTGGGAAGCCAGGGAAGGAGG + Intronic
1202160123 Y:21925212-21925234 CTTTGGGAAGCCAGGGAAGGAGG + Intergenic
1202184126 Y:22166572-22166594 CTTTGGGAAGCCAGGGAAGGAGG + Intergenic
1202207233 Y:22419829-22419851 CTTTGGGAAGCCAGGGAAGGAGG - Intergenic
1202231233 Y:22661175-22661197 CTTTGGGAAGCCAGGGAAGGAGG - Intergenic
1202311925 Y:23534990-23535012 CTTTGGGAAGCCAGGGAAGGAGG + Intergenic
1202558877 Y:26135604-26135626 CTTTGGGAAGCCAGGGAAGGAGG - Intergenic