ID: 987949027

View in Genome Browser
Species Human (GRCh38)
Location 5:24652361-24652383
Sequence TTCAGTACTGATATCGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987949027_987949031 -6 Left 987949027 5:24652361-24652383 CCTAACCCGATATCAGTACTGAA No data
Right 987949031 5:24652378-24652400 ACTGAAAAAACAGATGGAAAAGG No data
987949027_987949036 21 Left 987949027 5:24652361-24652383 CCTAACCCGATATCAGTACTGAA No data
Right 987949036 5:24652405-24652427 GAACGTCACAATTTCTGGCGGGG No data
987949027_987949032 -5 Left 987949027 5:24652361-24652383 CCTAACCCGATATCAGTACTGAA No data
Right 987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG No data
987949027_987949035 20 Left 987949027 5:24652361-24652383 CCTAACCCGATATCAGTACTGAA No data
Right 987949035 5:24652404-24652426 AGAACGTCACAATTTCTGGCGGG No data
987949027_987949033 16 Left 987949027 5:24652361-24652383 CCTAACCCGATATCAGTACTGAA No data
Right 987949033 5:24652400-24652422 GGCTAGAACGTCACAATTTCTGG No data
987949027_987949038 23 Left 987949027 5:24652361-24652383 CCTAACCCGATATCAGTACTGAA No data
Right 987949038 5:24652407-24652429 ACGTCACAATTTCTGGCGGGGGG No data
987949027_987949037 22 Left 987949027 5:24652361-24652383 CCTAACCCGATATCAGTACTGAA No data
Right 987949037 5:24652406-24652428 AACGTCACAATTTCTGGCGGGGG No data
987949027_987949034 19 Left 987949027 5:24652361-24652383 CCTAACCCGATATCAGTACTGAA No data
Right 987949034 5:24652403-24652425 TAGAACGTCACAATTTCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987949027 Original CRISPR TTCAGTACTGATATCGGGTT AGG (reversed) Intergenic
No off target data available for this crispr