ID: 987949032

View in Genome Browser
Species Human (GRCh38)
Location 5:24652379-24652401
Sequence CTGAAAAAACAGATGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987949028_987949032 -10 Left 987949028 5:24652366-24652388 CCCGATATCAGTACTGAAAAAAC No data
Right 987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG No data
987949027_987949032 -5 Left 987949027 5:24652361-24652383 CCTAACCCGATATCAGTACTGAA No data
Right 987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987949032 Original CRISPR CTGAAAAAACAGATGGAAAA GGG Intergenic
No off target data available for this crispr