ID: 987952071

View in Genome Browser
Species Human (GRCh38)
Location 5:24687861-24687883
Sequence GCAAAGATGCTGGCTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987952071_987952073 -5 Left 987952071 5:24687861-24687883 CCTGCTGCAGCCAGCATCTTTGC No data
Right 987952073 5:24687879-24687901 TTTGCAGCAGCTGCTCCAGATGG 0: 9
1: 14
2: 61
3: 127
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987952071 Original CRISPR GCAAAGATGCTGGCTGCAGC AGG (reversed) Intergenic
No off target data available for this crispr