ID: 987954676

View in Genome Browser
Species Human (GRCh38)
Location 5:24723090-24723112
Sequence CAGAGTAGTCATAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987954676_987954680 3 Left 987954676 5:24723090-24723112 CCTTCTTCCCTATGACTACTCTG No data
Right 987954680 5:24723116-24723138 AGTGCTCCTAAGCAGAAATATGG No data
987954676_987954681 6 Left 987954676 5:24723090-24723112 CCTTCTTCCCTATGACTACTCTG No data
Right 987954681 5:24723119-24723141 GCTCCTAAGCAGAAATATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987954676 Original CRISPR CAGAGTAGTCATAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr