ID: 987962717

View in Genome Browser
Species Human (GRCh38)
Location 5:24831235-24831257
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987962717_987962719 23 Left 987962717 5:24831235-24831257 CCATTATAAGAAAATCCACAAAC No data
Right 987962719 5:24831281-24831303 TAAGACAAAGTTTATTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987962717 Original CRISPR GTTTGTGGATTTTCTTATAA TGG (reversed) Intergenic
No off target data available for this crispr