ID: 987967099

View in Genome Browser
Species Human (GRCh38)
Location 5:24891530-24891552
Sequence ACAATTTGTGAGTGGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987967097_987967099 -3 Left 987967097 5:24891510-24891532 CCATTTACAATATTGTGAGAACA No data
Right 987967099 5:24891530-24891552 ACAATTTGTGAGTGGAGCCCTGG No data
987967096_987967099 22 Left 987967096 5:24891485-24891507 CCACTGGGAGGGTCTAGAAGACA No data
Right 987967099 5:24891530-24891552 ACAATTTGTGAGTGGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987967099 Original CRISPR ACAATTTGTGAGTGGAGCCC TGG Intergenic
No off target data available for this crispr