ID: 987968106

View in Genome Browser
Species Human (GRCh38)
Location 5:24903081-24903103
Sequence TGGACATGGGTGTGTCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987968106_987968110 -9 Left 987968106 5:24903081-24903103 CCTAGATGACACACCCATGTCCA No data
Right 987968110 5:24903095-24903117 CCATGTCCATGCTTCTTAATGGG No data
987968106_987968108 -10 Left 987968106 5:24903081-24903103 CCTAGATGACACACCCATGTCCA No data
Right 987968108 5:24903094-24903116 CCCATGTCCATGCTTCTTAATGG No data
987968106_987968112 6 Left 987968106 5:24903081-24903103 CCTAGATGACACACCCATGTCCA No data
Right 987968112 5:24903110-24903132 TTAATGGGCTGAAAATAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987968106 Original CRISPR TGGACATGGGTGTGTCATCT AGG (reversed) Intergenic
No off target data available for this crispr