ID: 987971098

View in Genome Browser
Species Human (GRCh38)
Location 5:24945634-24945656
Sequence TGTTAACTATAGTCACATTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987971097_987971098 16 Left 987971097 5:24945595-24945617 CCTTCTCTTCTAGCTATTTTAAA No data
Right 987971098 5:24945634-24945656 TGTTAACTATAGTCACATTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987971098 Original CRISPR TGTTAACTATAGTCACATTA CGG Intergenic
No off target data available for this crispr