ID: 987973016

View in Genome Browser
Species Human (GRCh38)
Location 5:24975519-24975541
Sequence ACTTCTACCCTCCTGCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987973013_987973016 1 Left 987973013 5:24975495-24975517 CCAGTAGGTACCCATTAAAGTTA No data
Right 987973016 5:24975519-24975541 ACTTCTACCCTCCTGCAGACAGG No data
987973012_987973016 14 Left 987973012 5:24975482-24975504 CCTTTTGTATTTGCCAGTAGGTA No data
Right 987973016 5:24975519-24975541 ACTTCTACCCTCCTGCAGACAGG No data
987973015_987973016 -10 Left 987973015 5:24975506-24975528 CCATTAAAGTTACACTTCTACCC No data
Right 987973016 5:24975519-24975541 ACTTCTACCCTCCTGCAGACAGG No data
987973014_987973016 -9 Left 987973014 5:24975505-24975527 CCCATTAAAGTTACACTTCTACC No data
Right 987973016 5:24975519-24975541 ACTTCTACCCTCCTGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987973016 Original CRISPR ACTTCTACCCTCCTGCAGAC AGG Intergenic
No off target data available for this crispr