ID: 987987886

View in Genome Browser
Species Human (GRCh38)
Location 5:25173235-25173257
Sequence CTTTCAGCTGAAACTCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987987886_987987888 -6 Left 987987886 5:25173235-25173257 CCTTTCAGAGTTTCAGCTGAAAG No data
Right 987987888 5:25173252-25173274 TGAAAGTTGAGGAAGTGTAATGG No data
987987886_987987890 13 Left 987987886 5:25173235-25173257 CCTTTCAGAGTTTCAGCTGAAAG No data
Right 987987890 5:25173271-25173293 ATGGGACTCTACCTATTTGATGG No data
987987886_987987889 -5 Left 987987886 5:25173235-25173257 CCTTTCAGAGTTTCAGCTGAAAG No data
Right 987987889 5:25173253-25173275 GAAAGTTGAGGAAGTGTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987987886 Original CRISPR CTTTCAGCTGAAACTCTGAA AGG (reversed) Intergenic
No off target data available for this crispr