ID: 987990962

View in Genome Browser
Species Human (GRCh38)
Location 5:25212349-25212371
Sequence ATGCCTTCCCTCTGAAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987990962_987990967 20 Left 987990962 5:25212349-25212371 CCAGATCTTCAGAGGGAAGGCAT No data
Right 987990967 5:25212392-25212414 GCACAGATGCTGAACTGAAGGGG No data
987990962_987990968 21 Left 987990962 5:25212349-25212371 CCAGATCTTCAGAGGGAAGGCAT No data
Right 987990968 5:25212393-25212415 CACAGATGCTGAACTGAAGGGGG No data
987990962_987990963 -10 Left 987990962 5:25212349-25212371 CCAGATCTTCAGAGGGAAGGCAT No data
Right 987990963 5:25212362-25212384 GGGAAGGCATTCAGAACAGATGG No data
987990962_987990965 18 Left 987990962 5:25212349-25212371 CCAGATCTTCAGAGGGAAGGCAT No data
Right 987990965 5:25212390-25212412 AGGCACAGATGCTGAACTGAAGG No data
987990962_987990966 19 Left 987990962 5:25212349-25212371 CCAGATCTTCAGAGGGAAGGCAT No data
Right 987990966 5:25212391-25212413 GGCACAGATGCTGAACTGAAGGG No data
987990962_987990964 -2 Left 987990962 5:25212349-25212371 CCAGATCTTCAGAGGGAAGGCAT No data
Right 987990964 5:25212370-25212392 ATTCAGAACAGATGGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987990962 Original CRISPR ATGCCTTCCCTCTGAAGATC TGG (reversed) Intergenic
No off target data available for this crispr