ID: 987993180

View in Genome Browser
Species Human (GRCh38)
Location 5:25241930-25241952
Sequence AAACCCTGCTTCACAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987993178_987993180 20 Left 987993178 5:25241887-25241909 CCAGTCTACTAGGTAATCTCATT No data
Right 987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987993180 Original CRISPR AAACCCTGCTTCACAAAGAT AGG Intergenic