ID: 987998000

View in Genome Browser
Species Human (GRCh38)
Location 5:25310660-25310682
Sequence AGTTATATACAGATAAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987998000_987998001 16 Left 987998000 5:25310660-25310682 CCTAGCTTTATCTGTATATAACT No data
Right 987998001 5:25310699-25310721 TATATAAAGTATTATTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987998000 Original CRISPR AGTTATATACAGATAAAGCT AGG (reversed) Intergenic
No off target data available for this crispr