ID: 988000359

View in Genome Browser
Species Human (GRCh38)
Location 5:25340270-25340292
Sequence CCTCGTCTACTGTAGTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988000357_988000359 -6 Left 988000357 5:25340253-25340275 CCTGATCAGCAAAAAGTCCTCGT No data
Right 988000359 5:25340270-25340292 CCTCGTCTACTGTAGTTGAATGG No data
988000356_988000359 -3 Left 988000356 5:25340250-25340272 CCTCCTGATCAGCAAAAAGTCCT No data
Right 988000359 5:25340270-25340292 CCTCGTCTACTGTAGTTGAATGG No data
988000355_988000359 5 Left 988000355 5:25340242-25340264 CCACAAGTCCTCCTGATCAGCAA No data
Right 988000359 5:25340270-25340292 CCTCGTCTACTGTAGTTGAATGG No data
988000354_988000359 6 Left 988000354 5:25340241-25340263 CCCACAAGTCCTCCTGATCAGCA No data
Right 988000359 5:25340270-25340292 CCTCGTCTACTGTAGTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988000359 Original CRISPR CCTCGTCTACTGTAGTTGAA TGG Intergenic
No off target data available for this crispr