ID: 988001512

View in Genome Browser
Species Human (GRCh38)
Location 5:25355484-25355506
Sequence GTTTGTGTATGTTAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988001508_988001512 2 Left 988001508 5:25355459-25355481 CCAATCCTATTTGCTGTTTATGT No data
Right 988001512 5:25355484-25355506 GTTTGTGTATGTTAGGAAGTGGG No data
988001509_988001512 -3 Left 988001509 5:25355464-25355486 CCTATTTGCTGTTTATGTATGTT No data
Right 988001512 5:25355484-25355506 GTTTGTGTATGTTAGGAAGTGGG No data
988001507_988001512 3 Left 988001507 5:25355458-25355480 CCCAATCCTATTTGCTGTTTATG No data
Right 988001512 5:25355484-25355506 GTTTGTGTATGTTAGGAAGTGGG No data
988001506_988001512 21 Left 988001506 5:25355440-25355462 CCATATATCACATTAGTACCCAA No data
Right 988001512 5:25355484-25355506 GTTTGTGTATGTTAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988001512 Original CRISPR GTTTGTGTATGTTAGGAAGT GGG Intergenic
No off target data available for this crispr