ID: 988005311

View in Genome Browser
Species Human (GRCh38)
Location 5:25402867-25402889
Sequence CTCTAAAAACAGCTCAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988005311_988005312 9 Left 988005311 5:25402867-25402889 CCTAGCTTGAGCTGTTTTTAGAG No data
Right 988005312 5:25402899-25402921 ATAAATGCATGTGATACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988005311 Original CRISPR CTCTAAAAACAGCTCAAGCT AGG (reversed) Intergenic
No off target data available for this crispr