ID: 988017148

View in Genome Browser
Species Human (GRCh38)
Location 5:25573849-25573871
Sequence CATTAGCAGTGAAACGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988017148_988017151 21 Left 988017148 5:25573849-25573871 CCAGATCCGTTTCACTGCTAATG No data
Right 988017151 5:25573893-25573915 AGCTACCTCCCTCTAGGCCCAGG No data
988017148_988017152 22 Left 988017148 5:25573849-25573871 CCAGATCCGTTTCACTGCTAATG No data
Right 988017152 5:25573894-25573916 GCTACCTCCCTCTAGGCCCAGGG No data
988017148_988017150 15 Left 988017148 5:25573849-25573871 CCAGATCCGTTTCACTGCTAATG No data
Right 988017150 5:25573887-25573909 TATACAAGCTACCTCCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988017148 Original CRISPR CATTAGCAGTGAAACGGATC TGG (reversed) Intergenic
No off target data available for this crispr