ID: 988026010

View in Genome Browser
Species Human (GRCh38)
Location 5:25690831-25690853
Sequence GATTATGCATGTTCAGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988026010_988026013 14 Left 988026010 5:25690831-25690853 CCATCAGCTGAACATGCATAATC No data
Right 988026013 5:25690868-25690890 CTTTCAGTTTAACAATGCAGTGG No data
988026010_988026014 15 Left 988026010 5:25690831-25690853 CCATCAGCTGAACATGCATAATC No data
Right 988026014 5:25690869-25690891 TTTCAGTTTAACAATGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988026010 Original CRISPR GATTATGCATGTTCAGCTGA TGG (reversed) Intergenic
No off target data available for this crispr