ID: 988026114

View in Genome Browser
Species Human (GRCh38)
Location 5:25692512-25692534
Sequence CTGCAAGCATAAATGGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988026106_988026114 28 Left 988026106 5:25692461-25692483 CCATCTTAGACCTGCCAACCCAT No data
Right 988026114 5:25692512-25692534 CTGCAAGCATAAATGGACCATGG No data
988026109_988026114 10 Left 988026109 5:25692479-25692501 CCCATGCATTCCCTAACTCAATG No data
Right 988026114 5:25692512-25692534 CTGCAAGCATAAATGGACCATGG No data
988026112_988026114 -1 Left 988026112 5:25692490-25692512 CCTAACTCAATGCACTTTTGAAC No data
Right 988026114 5:25692512-25692534 CTGCAAGCATAAATGGACCATGG No data
988026107_988026114 18 Left 988026107 5:25692471-25692493 CCTGCCAACCCATGCATTCCCTA No data
Right 988026114 5:25692512-25692534 CTGCAAGCATAAATGGACCATGG No data
988026110_988026114 9 Left 988026110 5:25692480-25692502 CCATGCATTCCCTAACTCAATGC No data
Right 988026114 5:25692512-25692534 CTGCAAGCATAAATGGACCATGG No data
988026108_988026114 14 Left 988026108 5:25692475-25692497 CCAACCCATGCATTCCCTAACTC No data
Right 988026114 5:25692512-25692534 CTGCAAGCATAAATGGACCATGG No data
988026111_988026114 0 Left 988026111 5:25692489-25692511 CCCTAACTCAATGCACTTTTGAA No data
Right 988026114 5:25692512-25692534 CTGCAAGCATAAATGGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988026114 Original CRISPR CTGCAAGCATAAATGGACCA TGG Intergenic
No off target data available for this crispr