ID: 988029124

View in Genome Browser
Species Human (GRCh38)
Location 5:25739507-25739529
Sequence TGGTGGGTCAGGAGGGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988029124_988029130 -10 Left 988029124 5:25739507-25739529 CCGCCCACCCTCCTGACCCACCA No data
Right 988029130 5:25739520-25739542 TGACCCACCACTGTCACTACCGG No data
988029124_988029135 13 Left 988029124 5:25739507-25739529 CCGCCCACCCTCCTGACCCACCA No data
Right 988029135 5:25739543-25739565 CACCTAAGCAAGCTATCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988029124 Original CRISPR TGGTGGGTCAGGAGGGTGGG CGG (reversed) Intergenic
No off target data available for this crispr