ID: 988029130

View in Genome Browser
Species Human (GRCh38)
Location 5:25739520-25739542
Sequence TGACCCACCACTGTCACTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988029122_988029130 13 Left 988029122 5:25739484-25739506 CCAGCTGCCAGGGGCTTGAGAGT No data
Right 988029130 5:25739520-25739542 TGACCCACCACTGTCACTACCGG No data
988029123_988029130 6 Left 988029123 5:25739491-25739513 CCAGGGGCTTGAGAGTCCGCCCA No data
Right 988029130 5:25739520-25739542 TGACCCACCACTGTCACTACCGG No data
988029116_988029130 30 Left 988029116 5:25739467-25739489 CCATCGCCCATAACATACCAGCT No data
Right 988029130 5:25739520-25739542 TGACCCACCACTGTCACTACCGG No data
988029119_988029130 23 Left 988029119 5:25739474-25739496 CCATAACATACCAGCTGCCAGGG No data
Right 988029130 5:25739520-25739542 TGACCCACCACTGTCACTACCGG No data
988029124_988029130 -10 Left 988029124 5:25739507-25739529 CCGCCCACCCTCCTGACCCACCA No data
Right 988029130 5:25739520-25739542 TGACCCACCACTGTCACTACCGG No data
988029117_988029130 24 Left 988029117 5:25739473-25739495 CCCATAACATACCAGCTGCCAGG No data
Right 988029130 5:25739520-25739542 TGACCCACCACTGTCACTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988029130 Original CRISPR TGACCCACCACTGTCACTAC CGG Intergenic
No off target data available for this crispr