ID: 988030363

View in Genome Browser
Species Human (GRCh38)
Location 5:25756087-25756109
Sequence CTAATTCAGAAGTTCTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988030363_988030366 19 Left 988030363 5:25756087-25756109 CCTTTAGAGAACTTCTGAATTAG No data
Right 988030366 5:25756129-25756151 CAATAAGACTGACTCCAGGGAGG No data
988030363_988030365 16 Left 988030363 5:25756087-25756109 CCTTTAGAGAACTTCTGAATTAG No data
Right 988030365 5:25756126-25756148 TTTCAATAAGACTGACTCCAGGG No data
988030363_988030364 15 Left 988030363 5:25756087-25756109 CCTTTAGAGAACTTCTGAATTAG No data
Right 988030364 5:25756125-25756147 TTTTCAATAAGACTGACTCCAGG No data
988030363_988030367 26 Left 988030363 5:25756087-25756109 CCTTTAGAGAACTTCTGAATTAG No data
Right 988030367 5:25756136-25756158 ACTGACTCCAGGGAGGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988030363 Original CRISPR CTAATTCAGAAGTTCTCTAA AGG (reversed) Intergenic
No off target data available for this crispr