ID: 988035418

View in Genome Browser
Species Human (GRCh38)
Location 5:25822210-25822232
Sequence ATGCTTACATTGATGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988035418_988035422 24 Left 988035418 5:25822210-25822232 CCATGTTCCATCAATGTAAGCAT No data
Right 988035422 5:25822257-25822279 TGAAGCCTTAAGTTGGAATTAGG No data
988035418_988035421 17 Left 988035418 5:25822210-25822232 CCATGTTCCATCAATGTAAGCAT No data
Right 988035421 5:25822250-25822272 CAAGCATTGAAGCCTTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988035418 Original CRISPR ATGCTTACATTGATGGAACA TGG (reversed) Intergenic
No off target data available for this crispr