ID: 988038848

View in Genome Browser
Species Human (GRCh38)
Location 5:25861963-25861985
Sequence GCAATAAATTCAAACATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988038848_988038851 0 Left 988038848 5:25861963-25861985 CCATGTATGTTTGAATTTATTGC No data
Right 988038851 5:25861986-25862008 CCATATTACTATCAGCATTTTGG 0: 83
1: 1191
2: 1927
3: 1641
4: 1109
988038848_988038853 26 Left 988038848 5:25861963-25861985 CCATGTATGTTTGAATTTATTGC No data
Right 988038853 5:25862012-25862034 AAACCATTCAACAAGTCTGTAGG 0: 7
1: 404
2: 2082
3: 2004
4: 1293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988038848 Original CRISPR GCAATAAATTCAAACATACA TGG (reversed) Intergenic
No off target data available for this crispr