ID: 988038849

View in Genome Browser
Species Human (GRCh38)
Location 5:25861985-25862007
Sequence CAAAATGCTGATAGTAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988038849_988038853 4 Left 988038849 5:25861985-25862007 CCCATATTACTATCAGCATTTTG No data
Right 988038853 5:25862012-25862034 AAACCATTCAACAAGTCTGTAGG 0: 7
1: 404
2: 2082
3: 2004
4: 1293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988038849 Original CRISPR CAAAATGCTGATAGTAATAT GGG (reversed) Intergenic
No off target data available for this crispr