ID: 988038850

View in Genome Browser
Species Human (GRCh38)
Location 5:25861986-25862008
Sequence CCAAAATGCTGATAGTAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5770
Summary {0: 89, 1: 1245, 2: 1904, 3: 1509, 4: 1023}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988038850_988038853 3 Left 988038850 5:25861986-25862008 CCATATTACTATCAGCATTTTGG 0: 89
1: 1245
2: 1904
3: 1509
4: 1023
Right 988038853 5:25862012-25862034 AAACCATTCAACAAGTCTGTAGG 0: 7
1: 404
2: 2082
3: 2004
4: 1293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988038850 Original CRISPR CCAAAATGCTGATAGTAATA TGG (reversed) Intergenic
Too many off-targets to display for this crispr