ID: 988038853

View in Genome Browser
Species Human (GRCh38)
Location 5:25862012-25862034
Sequence AAACCATTCAACAAGTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5790
Summary {0: 7, 1: 404, 2: 2082, 3: 2004, 4: 1293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988038849_988038853 4 Left 988038849 5:25861985-25862007 CCCATATTACTATCAGCATTTTG No data
Right 988038853 5:25862012-25862034 AAACCATTCAACAAGTCTGTAGG 0: 7
1: 404
2: 2082
3: 2004
4: 1293
988038850_988038853 3 Left 988038850 5:25861986-25862008 CCATATTACTATCAGCATTTTGG 0: 89
1: 1245
2: 1904
3: 1509
4: 1023
Right 988038853 5:25862012-25862034 AAACCATTCAACAAGTCTGTAGG 0: 7
1: 404
2: 2082
3: 2004
4: 1293
988038848_988038853 26 Left 988038848 5:25861963-25861985 CCATGTATGTTTGAATTTATTGC No data
Right 988038853 5:25862012-25862034 AAACCATTCAACAAGTCTGTAGG 0: 7
1: 404
2: 2082
3: 2004
4: 1293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988038853 Original CRISPR AAACCATTCAACAAGTCTGT AGG Intergenic
Too many off-targets to display for this crispr