ID: 988041889

View in Genome Browser
Species Human (GRCh38)
Location 5:25900356-25900378
Sequence TTCGTGATGGACCATCTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988041889_988041891 19 Left 988041889 5:25900356-25900378 CCAGGTAGATGGTCCATCACGAA No data
Right 988041891 5:25900398-25900420 TGATCATGACATACTCCGTCTGG No data
988041889_988041892 28 Left 988041889 5:25900356-25900378 CCAGGTAGATGGTCCATCACGAA No data
Right 988041892 5:25900407-25900429 CATACTCCGTCTGGTTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988041889 Original CRISPR TTCGTGATGGACCATCTACC TGG (reversed) Intergenic
No off target data available for this crispr