ID: 988042821

View in Genome Browser
Species Human (GRCh38)
Location 5:25910737-25910759
Sequence GACTCAGGAATAGCTGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988042815_988042821 -4 Left 988042815 5:25910718-25910740 CCTCCCGGGACCAGAAAAAGACT No data
Right 988042821 5:25910737-25910759 GACTCAGGAATAGCTGGCCTTGG 0: 1
1: 0
2: 0
3: 13
4: 149
988042816_988042821 -7 Left 988042816 5:25910721-25910743 CCCGGGACCAGAAAAAGACTCAG No data
Right 988042821 5:25910737-25910759 GACTCAGGAATAGCTGGCCTTGG 0: 1
1: 0
2: 0
3: 13
4: 149
988042812_988042821 17 Left 988042812 5:25910697-25910719 CCAAGGAAGTCTTGCTGCAGGCC 0: 1
1: 0
2: 2
3: 21
4: 221
Right 988042821 5:25910737-25910759 GACTCAGGAATAGCTGGCCTTGG 0: 1
1: 0
2: 0
3: 13
4: 149
988042817_988042821 -8 Left 988042817 5:25910722-25910744 CCGGGACCAGAAAAAGACTCAGG No data
Right 988042821 5:25910737-25910759 GACTCAGGAATAGCTGGCCTTGG 0: 1
1: 0
2: 0
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988042821 Original CRISPR GACTCAGGAATAGCTGGCCT TGG Intergenic
900596548 1:3482701-3482723 GAGTCAGGAAGCGCAGGCCTGGG + Intergenic
900692285 1:3987949-3987971 GGCTCAGAAATAGGTGGCCTAGG + Intergenic
901708004 1:11090870-11090892 GCCTCTGGAATAGCTGAACTGGG + Intronic
904315255 1:29655978-29656000 GACTCAGCCCTAGATGGCCTGGG - Intergenic
907413781 1:54300292-54300314 AGCACAGGAAGAGCTGGCCTGGG + Intronic
913068175 1:115276276-115276298 GACTCAGGAATGCTTAGCCTGGG + Intergenic
915147311 1:153802725-153802747 GACTGTGGAACAGCTGGCCTTGG + Intergenic
915235675 1:154479216-154479238 GACTCAGGAAGAGATGGGCCAGG + Intronic
915339402 1:155167978-155168000 CCCTCAGGGATAGCTTGCCTAGG + Intergenic
919834297 1:201563182-201563204 GACTCAGGGCTAGCTGCCCCTGG + Intergenic
920850761 1:209626655-209626677 GACGCAGGAACAGCGGGCATAGG + Intronic
922453071 1:225752091-225752113 CAGTCAGAAATAGCTGGCTTTGG - Intergenic
922571714 1:226638272-226638294 GACTCAGGAATTGGAGGACTTGG + Intronic
923507446 1:234617344-234617366 CACTCAAGAAAAACTGGCCTAGG - Intergenic
924155382 1:241170011-241170033 GACTCTGGGATAGCTACCCTGGG + Intronic
1063692322 10:8298426-8298448 GCCTCATGAGTAGCTGGGCTGGG + Intergenic
1066104706 10:32146316-32146338 CACTCAGGAATGTCTGGACTGGG - Intergenic
1072409276 10:95184905-95184927 GACACAGGAGCAGGTGGCCTGGG - Intergenic
1072618955 10:97067425-97067447 TACTCAGGCAGTGCTGGCCTGGG - Intronic
1076599527 10:131647886-131647908 CACACAGGGACAGCTGGCCTGGG - Intergenic
1077229844 11:1453850-1453872 GACTCAGGCAGAGCGCGCCTGGG - Intronic
1080807273 11:35664611-35664633 GAATAGGGAATAGCTGGCATTGG + Intronic
1084296449 11:68215665-68215687 TGCTCAGGCATAGCTGGACTTGG - Intergenic
1084968769 11:72758170-72758192 CAGGCAGGTATAGCTGGCCTGGG - Intronic
1086374447 11:86186028-86186050 AACTCAGGTCTAGCTGGCCGTGG - Intergenic
1086998271 11:93384611-93384633 GACTAAAGAATAGCTGCCATTGG + Intronic
1088452043 11:109992664-109992686 CAGTCAGGAAGAGGTGGCCTAGG - Intergenic
1089113096 11:116072468-116072490 GACCCTAGAAGAGCTGGCCTGGG - Intergenic
1090299169 11:125619735-125619757 TCCTCAGGAATAGAGGGCCTTGG + Intronic
1094622191 12:32090495-32090517 GAGAGAGGAATACCTGGCCTAGG + Intergenic
1102240325 12:111320870-111320892 GACTCAGGAATGAAGGGCCTGGG - Intronic
1102604006 12:114054852-114054874 GACTCAGCAATAGCTGTCAAGGG - Intergenic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1108040843 13:46338317-46338339 GGCTCAGGTATAGCTAGCATTGG + Intergenic
1108546504 13:51500681-51500703 GACTCAGAAAGAGCAGCCCTGGG + Intergenic
1108620058 13:52173275-52173297 AACTCTGAAATAGCTGGCCTAGG + Intergenic
1108666686 13:52639841-52639863 AACTCTGAAATAGTTGGCCTAGG - Intergenic
1114474853 14:22987150-22987172 GTCTCAGAAATAGGTGGCCATGG - Exonic
1119522858 14:75298890-75298912 GGCCCAGGGATATCTGGCCTTGG + Intergenic
1122105963 14:99455189-99455211 CACTCAGGAATACCCGGCCCAGG + Intronic
1122269511 14:100562258-100562280 AACTCAGGAAGAGATGTCCTGGG - Intronic
1124693601 15:31845619-31845641 CCCTCAGGAAGGGCTGGCCTGGG + Intronic
1128802263 15:70504378-70504400 GAGTAAGGCACAGCTGGCCTGGG - Intergenic
1133239026 16:4403808-4403830 GACTCAGGGATGGCTGCCTTGGG - Intronic
1133767273 16:8846801-8846823 GTCTCTGGAACAGGTGGCCTGGG - Intronic
1133998154 16:10762954-10762976 GGCTCAGGAGTGGCTGCCCTGGG + Intronic
1134610094 16:15601229-15601251 GACCCAGGCAAAGCTTGCCTGGG - Intronic
1134833569 16:17343367-17343389 GACTCAGGCATAGGTGGGCTTGG + Intronic
1136153312 16:28366080-28366102 GACACAGGAGCAGGTGGCCTGGG - Intergenic
1136209774 16:28749187-28749209 GACACAGGAGCAGGTGGCCTGGG + Intergenic
1137855179 16:51787456-51787478 GGCACAGGAAAAGCTGTCCTCGG - Intergenic
1138350762 16:56345161-56345183 GACGCAGGTCTGGCTGGCCTTGG + Exonic
1138379462 16:56590104-56590126 CACCCAGGAATTGATGGCCTAGG + Intronic
1140038386 16:71388875-71388897 GCCTCCCGAATAGCTGGGCTGGG - Intronic
1140416458 16:74777113-74777135 GTCTCAGGAATCCCTGGCCCTGG - Intergenic
1142549676 17:731211-731233 GACTTCGGAACAGCTGGGCTCGG - Intergenic
1144703072 17:17351158-17351180 GTGTCAAGAAGAGCTGGCCTAGG - Intergenic
1145736972 17:27239937-27239959 GGCTCAGTAATAGCGGGCATGGG - Intergenic
1148724349 17:49777757-49777779 GGCTCAGGAATACCAGGCCCAGG + Intronic
1157188614 18:45561420-45561442 GCCTCTGGAACACCTGGCCTGGG - Intronic
1157609214 18:48945756-48945778 GTTTGAGGAATGGCTGGCCTTGG - Intronic
1158568094 18:58572374-58572396 GACTCAGCAATGACTGTCCTGGG + Intronic
1159235206 18:65662798-65662820 GACTCAGATTTAACTGGCCTGGG - Intergenic
1166885203 19:45956273-45956295 GCCCCAGGAAGAGCTGGCCGAGG + Intronic
1166939155 19:46352413-46352435 GAGGCAGGAGTAGGTGGCCTGGG - Intronic
925827847 2:7867567-7867589 GACACAGGAATCTCTGGACTGGG - Intergenic
926249934 2:11149096-11149118 GACTCAGCAATAACTGACTTAGG + Intergenic
926378686 2:12262198-12262220 GGCTCAGGAATACCTCCCCTGGG - Intergenic
927363609 2:22267489-22267511 TACTCAGGAAGATCTTGCCTAGG - Intergenic
927675077 2:25099311-25099333 GAGCCAGGAATGGCTGTCCTGGG + Intronic
929671684 2:43880921-43880943 GACTCAGGGAAAGCTGGACTTGG - Intergenic
931464357 2:62473705-62473727 GCCTCAGGAATACCAGGACTGGG + Intergenic
935763081 2:106339549-106339571 GTTTCAGGAATAGGTGACCTTGG - Intergenic
937917263 2:127105438-127105460 GCCCCAGGAATAGCTGGCTGGGG - Intronic
938203969 2:129401488-129401510 GACTGAGGAATAGAAGGCTTGGG + Intergenic
939610955 2:144310240-144310262 GTTTCTGGAATAGCTGGCCTTGG - Intronic
940145764 2:150542665-150542687 GACTCAGGCATGGCGGGCTTTGG + Intergenic
941709559 2:168697812-168697834 AAAGCAGGAATAGCTGTCCTTGG + Intronic
942315724 2:174694752-174694774 GACTAAGAAATTTCTGGCCTTGG - Intergenic
945362268 2:208906465-208906487 GCATCAGGAATAGCTTCCCTGGG - Intergenic
947154680 2:227150215-227150237 GAATGAGGGATAACTGGCCTTGG + Intronic
948136765 2:235642380-235642402 GACTGAGGAAAACCTGGCTTAGG + Intronic
948815157 2:240506754-240506776 GACACAGGAAGGGCTGGCATGGG + Intronic
949074180 2:242044764-242044786 GACTTGGGAACACCTGGCCTTGG + Intergenic
1170100529 20:12694249-12694271 GACTCAGGTCTAACTGGCCAAGG + Intergenic
1173306466 20:41855295-41855317 AACTCAGGAGTAGCTTGGCTGGG - Intergenic
1174118152 20:48242038-48242060 GAGTCAGGAATGGTTTGCCTTGG - Intergenic
1174315431 20:49696632-49696654 ACCTCAGGAATTGCTGGGCTGGG - Intronic
1174323207 20:49758798-49758820 TGCTCAGGAAGAGCTAGCCTTGG - Intergenic
1175170075 20:57074209-57074231 GAATCAGGCAGAGCTGGGCTTGG - Intergenic
1175855337 20:62118077-62118099 GGCTCAGGAATGGCTGGGGTGGG - Intergenic
1177886670 21:26755333-26755355 GACACTGGAAGGGCTGGCCTTGG + Intergenic
1182954259 22:34406576-34406598 CCCTCAGGAAGTGCTGGCCTGGG - Intergenic
1184387060 22:44182311-44182333 GAGTGAGGAGGAGCTGGCCTGGG + Intronic
1184450282 22:44578485-44578507 GGCTTAGGAAGAGCTGGCCCAGG - Intergenic
950002361 3:9667003-9667025 GACTCGGGTTTTGCTGGCCTAGG + Intronic
952534227 3:34293530-34293552 GACTCAGGAAAAGCAGACCAAGG - Intergenic
954517622 3:51192811-51192833 GAATCAGGAATGGCTTCCCTTGG - Intronic
956948625 3:74253669-74253691 GGCTCAGGACTAGCTAGGCTAGG + Intergenic
959390756 3:105770456-105770478 TATTCAGGAATAGCTTCCCTGGG - Intronic
962390623 3:134969036-134969058 GACTCAATAAGAGCTTGCCTGGG - Intronic
963907004 3:150781006-150781028 GACTCAGTAAGAGATGACCTAGG - Intergenic
964477078 3:157106928-157106950 GACTAATGAGTGGCTGGCCTTGG + Intergenic
965357130 3:167689772-167689794 GGCTTAGGAATAAATGGCCTTGG - Intronic
965410022 3:168318952-168318974 GGCTAAGGAATTGCTGGCCTTGG - Intergenic
966141334 3:176759849-176759871 GTCTCAGGAAGAGGTGGGCTGGG + Intergenic
967971268 3:195001441-195001463 GACTCAAGACTAGCCGGCCTTGG + Intergenic
967976862 3:195040404-195040426 GACTCTCCAATAGCTGGCTTGGG - Intergenic
974414448 4:61587890-61587912 GATTAAGGATTAGTTGGCCTTGG + Intronic
977510293 4:97953559-97953581 GAATCAGGAATGGCTTCCCTTGG + Intronic
980926633 4:139144360-139144382 GAATCAGGAATAGCTTCCCTTGG - Intronic
981711189 4:147710214-147710236 GACTCAGGATGTGCTGGCATGGG - Intergenic
982717412 4:158823622-158823644 TACTCAGGAACAGCTGGCTTTGG + Intronic
987173955 5:15287708-15287730 GACTCAAGAAAAGCTGGCCCTGG + Intergenic
988042821 5:25910737-25910759 GACTCAGGAATAGCTGGCCTTGG + Intergenic
990663919 5:58050816-58050838 GACTCAGGAAGAAGTAGCCTAGG + Intergenic
994399154 5:99257132-99257154 TAGTCAGGAATAGCTTCCCTGGG + Intergenic
995064848 5:107849233-107849255 GACTCAGGAATTCCAGTCCTAGG - Intergenic
995186786 5:109280565-109280587 GAATCAGGAATGGCTTCCCTTGG - Intergenic
995282043 5:110347099-110347121 GACAAAGGAATTGCTGGCCAAGG - Intronic
1000237467 5:159376043-159376065 TAATCAGGAATAGCTTCCCTGGG - Intergenic
1002198875 5:177515850-177515872 GCCCTGGGAATAGCTGGCCTGGG + Intronic
1002471686 5:179439344-179439366 GACAGAGGAAGGGCTGGCCTGGG + Intergenic
1002581275 5:180210742-180210764 GGAGCAGGAATAGCAGGCCTGGG + Intergenic
1006915440 6:37591043-37591065 GACTCCGGAAAGGCTGGCATTGG - Intergenic
1011535327 6:88370305-88370327 GACTCAGCAATAACTCCCCTTGG - Intergenic
1012154955 6:95807406-95807428 GACTCAGCAATAGTTCCCCTAGG - Intergenic
1012632268 6:101486120-101486142 GACTGAGGAATACCATGCCTTGG + Intronic
1015656989 6:135530396-135530418 GGCTCAGGCAAAGCTTGCCTTGG - Intergenic
1020008153 7:4793042-4793064 GACTTAGCACCAGCTGGCCTGGG - Intronic
1020010980 7:4805629-4805651 GACTCACTACCAGCTGGCCTCGG - Exonic
1023679620 7:42672162-42672184 GACTCAGGAAAACCTGTCCCTGG + Intergenic
1024182528 7:46910288-46910310 GACTCTGGAATACCTGCCTTTGG - Intergenic
1024333413 7:48179357-48179379 CACTCACGAAGAGCTGACCTCGG - Intronic
1031181200 7:118418034-118418056 GACACTGAAATACCTGGCCTGGG + Intergenic
1032165127 7:129539469-129539491 GACTCAGAAGGAGCTGGTCTGGG - Intergenic
1035223368 7:157419660-157419682 GACTGAGAAGTAGCTGGCATGGG - Intergenic
1035611608 8:969230-969252 GACCCAGGAAGAGCTGACATCGG - Intergenic
1035690713 8:1557690-1557712 GGCTCAGCAGGAGCTGGCCTTGG - Intronic
1035934075 8:3817826-3817848 GACTCTGGGAAAGCTGGACTTGG - Intronic
1038107898 8:24456966-24456988 GACTCAGGAATATCACTCCTTGG - Intronic
1038355301 8:26823674-26823696 GGATCAGGACTAGTTGGCCTAGG + Intronic
1041039781 8:53835345-53835367 GGCTCAGGGAAAGCTGTCCTGGG - Intronic
1041254025 8:55963531-55963553 GACTCTGGAGCAGCTGCCCTAGG - Intronic
1042286426 8:67116963-67116985 GACTCAGGAATAGGAGGCATTGG + Intronic
1042528643 8:69792726-69792748 GTCTCAACAATAGGTGGCCTAGG + Intronic
1046016074 8:108606896-108606918 AACTCAGGAATAGCTTGACTGGG + Intronic
1051994445 9:23198005-23198027 GGCTCAGAAAGAGCTTGCCTGGG - Intergenic
1057810583 9:98254030-98254052 AACTCAGGAATCCCTGGCCAGGG - Intronic
1059627174 9:116079791-116079813 GACTTAGGAGTAGCTGACTTAGG + Intergenic
1059957943 9:119537522-119537544 GACTCAGGATTAGAGGACCTTGG + Intergenic
1060036995 9:120264217-120264239 GACGCAGGAGAAGCTGGGCTGGG - Intergenic
1061452759 9:130677558-130677580 GACTCCAGAAGTGCTGGCCTTGG - Intronic
1061879879 9:133563251-133563273 TACCCAGGAGCAGCTGGCCTTGG + Intronic
1061963736 9:134001566-134001588 CACTCAACAATAGCAGGCCTTGG + Intergenic
1062023752 9:134331045-134331067 GACTCAGGAATAGAGGACATCGG + Intronic
1185528783 X:800573-800595 GACTTCAGAATGGCTGGCCTGGG + Intergenic
1186677839 X:11838294-11838316 AATTCATGAATAGATGGCCTGGG + Intergenic
1187554534 X:20339377-20339399 GACTCTGGGCTGGCTGGCCTTGG + Intergenic
1189728827 X:43997385-43997407 TACTCAGGAAAGGCTGCCCTGGG + Intergenic
1196356373 X:114798365-114798387 TTCTCAAGAATACCTGGCCTTGG + Intronic
1196757558 X:119171249-119171271 CACCAAGGAAAAGCTGGCCTTGG + Intergenic
1197316302 X:124970390-124970412 GCCTGAGGAATAGCTGGCAAAGG + Intergenic