ID: 988042989

View in Genome Browser
Species Human (GRCh38)
Location 5:25911876-25911898
Sequence CAATTTCTCCCCAGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988042981_988042989 26 Left 988042981 5:25911827-25911849 CCTGTTACAAACTCAGCCTCAAT No data
Right 988042989 5:25911876-25911898 CAATTTCTCCCCAGGGTGGATGG No data
988042982_988042989 10 Left 988042982 5:25911843-25911865 CCTCAATAAGCCTTGTTGTTGAC No data
Right 988042989 5:25911876-25911898 CAATTTCTCCCCAGGGTGGATGG No data
988042985_988042989 0 Left 988042985 5:25911853-25911875 CCTTGTTGTTGACTTTAGGGACT No data
Right 988042989 5:25911876-25911898 CAATTTCTCCCCAGGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988042989 Original CRISPR CAATTTCTCCCCAGGGTGGA TGG Intergenic
No off target data available for this crispr