ID: 988046114

View in Genome Browser
Species Human (GRCh38)
Location 5:25956202-25956224
Sequence CCTCATAATTGCCCATGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988046111_988046114 24 Left 988046111 5:25956155-25956177 CCTCTGAAATAATCAAAAATAAA No data
Right 988046114 5:25956202-25956224 CCTCATAATTGCCCATGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988046114 Original CRISPR CCTCATAATTGCCCATGAAA AGG Intergenic
No off target data available for this crispr