ID: 988050140

View in Genome Browser
Species Human (GRCh38)
Location 5:26017147-26017169
Sequence ATGTTGGTATACATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988050140_988050142 9 Left 988050140 5:26017147-26017169 CCATGTTTCATGTATACCAACAT No data
Right 988050142 5:26017179-26017201 CATTATTTAAAGTAGCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988050140 Original CRISPR ATGTTGGTATACATGAAACA TGG (reversed) Intergenic
No off target data available for this crispr