ID: 988054252

View in Genome Browser
Species Human (GRCh38)
Location 5:26072899-26072921
Sequence TTGCTTCCCATGAAGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988054252_988054253 1 Left 988054252 5:26072899-26072921 CCTGTTTTCTTCATGGGAAGCAA No data
Right 988054253 5:26072923-26072945 TTCAGAAAAAAACCCATTTTAGG No data
988054252_988054256 26 Left 988054252 5:26072899-26072921 CCTGTTTTCTTCATGGGAAGCAA No data
Right 988054256 5:26072948-26072970 CATGCTACTTTTTTGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988054252 Original CRISPR TTGCTTCCCATGAAGAAAAC AGG (reversed) Intergenic
No off target data available for this crispr