ID: 988055972 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:26097244-26097266 |
| Sequence | CAGAAAAGTTTGCTGGAGTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 988055972_988055977 | 15 | Left | 988055972 | 5:26097244-26097266 | CCAGACTCCAGCAAACTTTTCTG | No data | ||
| Right | 988055977 | 5:26097282-26097304 | CTTTTACTGTCTTAAATCATTGG | No data | ||||
| 988055972_988055978 | 24 | Left | 988055972 | 5:26097244-26097266 | CCAGACTCCAGCAAACTTTTCTG | No data | ||
| Right | 988055978 | 5:26097291-26097313 | TCTTAAATCATTGGAGTTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 988055972 | Original CRISPR | CAGAAAAGTTTGCTGGAGTC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||