ID: 988055972

View in Genome Browser
Species Human (GRCh38)
Location 5:26097244-26097266
Sequence CAGAAAAGTTTGCTGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988055972_988055977 15 Left 988055972 5:26097244-26097266 CCAGACTCCAGCAAACTTTTCTG No data
Right 988055977 5:26097282-26097304 CTTTTACTGTCTTAAATCATTGG No data
988055972_988055978 24 Left 988055972 5:26097244-26097266 CCAGACTCCAGCAAACTTTTCTG No data
Right 988055978 5:26097291-26097313 TCTTAAATCATTGGAGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988055972 Original CRISPR CAGAAAAGTTTGCTGGAGTC TGG (reversed) Intergenic
No off target data available for this crispr