ID: 988062448

View in Genome Browser
Species Human (GRCh38)
Location 5:26189846-26189868
Sequence AGTTTAAAGAGACAATGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988062448_988062451 17 Left 988062448 5:26189846-26189868 CCAGATCATTGTCTCTTTAAACT No data
Right 988062451 5:26189886-26189908 TATGTGAATTTTCTTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988062448 Original CRISPR AGTTTAAAGAGACAATGATC TGG (reversed) Intergenic
No off target data available for this crispr