ID: 988065697

View in Genome Browser
Species Human (GRCh38)
Location 5:26227422-26227444
Sequence CTGGAGACCCAGAGGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988065697_988065702 -3 Left 988065697 5:26227422-26227444 CCAGCTCCCCTCTGGGTCTCCAG No data
Right 988065702 5:26227442-26227464 CAGCTGCACGAACCTCAAACTGG No data
988065697_988065705 17 Left 988065697 5:26227422-26227444 CCAGCTCCCCTCTGGGTCTCCAG No data
Right 988065705 5:26227462-26227484 TGGAACATCAGCTCTTCTCTGGG No data
988065697_988065704 16 Left 988065697 5:26227422-26227444 CCAGCTCCCCTCTGGGTCTCCAG No data
Right 988065704 5:26227461-26227483 CTGGAACATCAGCTCTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988065697 Original CRISPR CTGGAGACCCAGAGGGGAGC TGG (reversed) Intergenic
No off target data available for this crispr