ID: 988067301

View in Genome Browser
Species Human (GRCh38)
Location 5:26237587-26237609
Sequence CGACGTGTGGCCTTTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988067295_988067301 22 Left 988067295 5:26237542-26237564 CCATCTCTAGGATTCGCTTATTC No data
Right 988067301 5:26237587-26237609 CGACGTGTGGCCTTTCCTGGTGG No data
988067298_988067301 0 Left 988067298 5:26237564-26237586 CCGGACATCGATAAAAATGGAAT No data
Right 988067301 5:26237587-26237609 CGACGTGTGGCCTTTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988067301 Original CRISPR CGACGTGTGGCCTTTCCTGG TGG Intergenic
No off target data available for this crispr