ID: 988071932

View in Genome Browser
Species Human (GRCh38)
Location 5:26302011-26302033
Sequence TTATGAAGCCCCGGATTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988071929_988071932 -8 Left 988071929 5:26301996-26302018 CCACAGATCTAAGAGTTATGAAG No data
Right 988071932 5:26302011-26302033 TTATGAAGCCCCGGATTAGGTGG No data
988071928_988071932 11 Left 988071928 5:26301977-26301999 CCTTGAGCAGATATGAAGTCCAC No data
Right 988071932 5:26302011-26302033 TTATGAAGCCCCGGATTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988071932 Original CRISPR TTATGAAGCCCCGGATTAGG TGG Intergenic
No off target data available for this crispr