ID: 988073576

View in Genome Browser
Species Human (GRCh38)
Location 5:26324851-26324873
Sequence GCTGCCTGCCAGTCCCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988073576_988073583 10 Left 988073576 5:26324851-26324873 CCAGTGTGGGACTGGCAGGCAGC No data
Right 988073583 5:26324884-26324906 GCCCCGGTGCGGGATCCACTGGG 0: 212
1: 565
2: 604
3: 404
4: 306
988073576_988073582 9 Left 988073576 5:26324851-26324873 CCAGTGTGGGACTGGCAGGCAGC No data
Right 988073582 5:26324883-26324905 AGCCCCGGTGCGGGATCCACTGG 0: 112
1: 321
2: 367
3: 306
4: 232
988073576_988073579 0 Left 988073576 5:26324851-26324873 CCAGTGTGGGACTGGCAGGCAGC No data
Right 988073579 5:26324874-26324896 TCCACCTGCAGCCCCGGTGCGGG 0: 240
1: 476
2: 385
3: 264
4: 405
988073576_988073578 -1 Left 988073576 5:26324851-26324873 CCAGTGTGGGACTGGCAGGCAGC No data
Right 988073578 5:26324873-26324895 CTCCACCTGCAGCCCCGGTGCGG 0: 249
1: 456
2: 284
3: 205
4: 385
988073576_988073577 -6 Left 988073576 5:26324851-26324873 CCAGTGTGGGACTGGCAGGCAGC No data
Right 988073577 5:26324868-26324890 GGCAGCTCCACCTGCAGCCCCGG 0: 480
1: 298
2: 198
3: 186
4: 717

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988073576 Original CRISPR GCTGCCTGCCAGTCCCACAC TGG (reversed) Intergenic
No off target data available for this crispr