ID: 988074540

View in Genome Browser
Species Human (GRCh38)
Location 5:26336126-26336148
Sequence GTTCTTGGTCAGGTGGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988074535_988074540 -7 Left 988074535 5:26336110-26336132 CCTTGCAGTATTGAAAGTTCTTG No data
Right 988074540 5:26336126-26336148 GTTCTTGGTCAGGTGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988074540 Original CRISPR GTTCTTGGTCAGGTGGCCTT GGG Intergenic
No off target data available for this crispr