ID: 988076689

View in Genome Browser
Species Human (GRCh38)
Location 5:26363180-26363202
Sequence CCATCTTGGCCCCACCTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988076686_988076689 -9 Left 988076686 5:26363166-26363188 CCGTTTCTAGTCGGCCATCTTGG No data
Right 988076689 5:26363180-26363202 CCATCTTGGCCCCACCTAATTGG No data
988076685_988076689 -2 Left 988076685 5:26363159-26363181 CCTGCAGCCGTTTCTAGTCGGCC No data
Right 988076689 5:26363180-26363202 CCATCTTGGCCCCACCTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988076689 Original CRISPR CCATCTTGGCCCCACCTAAT TGG Intergenic
No off target data available for this crispr