ID: 988076760

View in Genome Browser
Species Human (GRCh38)
Location 5:26363821-26363843
Sequence CAATATGCTGATAGTGATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988076757_988076760 -4 Left 988076757 5:26363802-26363824 CCTGGTGAATGGTTGTGACCAAT No data
Right 988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG No data
988076755_988076760 4 Left 988076755 5:26363794-26363816 CCCAGAAACCTGGTGAATGGTTG No data
Right 988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG No data
988076756_988076760 3 Left 988076756 5:26363795-26363817 CCAGAAACCTGGTGAATGGTTGT No data
Right 988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988076760 Original CRISPR CAATATGCTGATAGTGATAA GGG Intergenic
No off target data available for this crispr