ID: 988077112

View in Genome Browser
Species Human (GRCh38)
Location 5:26367240-26367262
Sequence CTGTAGGCACTAATTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988077107_988077112 -10 Left 988077107 5:26367227-26367249 CCCCTGGTATTACCTGTAGGCAC No data
Right 988077112 5:26367240-26367262 CTGTAGGCACTAATTGTGGTTGG No data
988077106_988077112 -9 Left 988077106 5:26367226-26367248 CCCCCTGGTATTACCTGTAGGCA No data
Right 988077112 5:26367240-26367262 CTGTAGGCACTAATTGTGGTTGG No data
988077104_988077112 -2 Left 988077104 5:26367219-26367241 CCTCAGGCCCCCTGGTATTACCT No data
Right 988077112 5:26367240-26367262 CTGTAGGCACTAATTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988077112 Original CRISPR CTGTAGGCACTAATTGTGGT TGG Intergenic
No off target data available for this crispr